Mutagenetix > Incidental Mutation

Incidental Mutation 'R3024:Pes1'

265777

Institutional Source

Beutler Lab

Gene Symbol

Pes1

Ensembl Gene

ENSMUSG00000020430

Gene Name

pescadillo ribosomal biogenesis factor 1

Synonyms

MMRRC Submission

040540-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3024 (G1)

Quality Score

120

Status

Not validated

Chromosome

Chromosomal Location

3963975-3980004 bp(+) (GRCm38)

Type of Mutation

small deletion (1 aa in frame mutation)

DNA Base Change (assembly)

CGGAGGAGGAGGAGGAGGAGGAGG to CGGAGGAGGAGGAGGAGGAGG at 3977719 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020705] [ENSMUST00000042344] [ENSMUST00000109985]

AlphaFold

Q9EQ61

Predicted Effect

probably benign
Transcript: ENSMUST00000020705

SMART Domains

Protein: ENSMUSP00000020705
Gene: ENSMUSG00000020430

Domain	Start	End	E-Value	Type
Pfam:Pescadillo_N	6	286	5.1e-135	PFAM
BRCT	323	404	4.81e-7	SMART
coiled coil region	469	542	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000042344

SMART Domains

Protein: ENSMUSP00000048953
Gene: ENSMUSG00000034493

Domain	Start	End	E-Value	Type
low complexity region	23	40	N/A	INTRINSIC
low complexity region	84	93	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109985

SMART Domains

Protein: ENSMUSP00000105612
Gene: ENSMUSG00000020430

Domain	Start	End	E-Value	Type
Pfam:Pescadillo_N	7	284	1.1e-130	PFAM
BRCT	327	408	4.81e-7	SMART
coiled coil region	473	546	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137544

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that contains a breast cancer associated gene 1 (BRCA1) C-terminal interaction domain. The encoded protein interacts with BOP1 and WDR12 to form the PeBoW complex, which plays a critical role in cell proliferation via pre-rRNA processing and 60S ribosomal subunit maturation. Expression of this gene may play an important role in breast cancer proliferation and tumorigenicity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the long arm of chromosome 4 and the short arm of chromosome 9. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted disuption of the mouse gene results in embryonic arrest at morula stages of development, as well as failure of nucleologenesis and disruption of ribosome biogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef37	T	C	18: 61,501,888	E461G	probably damaging	Het
Bfsp1	A	T	2: 143,845,959	V182D	probably benign	Het
Birc6	T	C	17: 74,608,219	S1635P	possibly damaging	Het
Chil6	T	C	3: 106,388,770	D383G	probably damaging	Het
Itpr2	G	A	6: 146,180,310	A175V	probably benign	Het
Kcnh7	G	T	2: 62,764,663	R688S	probably damaging	Het
Krt6a	A	T	15: 101,691,289	C463S	probably benign	Het
Ksr2	T	A	5: 117,555,060	I191N	possibly damaging	Het
Lyst	T	C	13: 13,658,687	V1698A	probably benign	Het
Olfr103	A	T	17: 37,337,027	D68E	probably damaging	Het
Olfr1262	A	T	2: 90,003,240	N278I	probably damaging	Het
Pappa2	C	T	1: 158,936,225	R572Q	probably benign	Het
Phf20	A	G	2: 156,287,867	H453R	probably damaging	Het
Prex1	G	T	2: 166,589,036	H615Q	probably benign	Het
Slc25a54	T	A	3: 109,080,666	I41N	probably damaging	Het
Slc35f5	A	G	1: 125,568,598	S157G	probably benign	Het
Sstr3	G	A	15: 78,539,987	R187W	probably damaging	Het
Trim41	T	C	11: 48,808,158	K420E	possibly damaging	Het
Tsnaxip1	A	G	8: 105,841,743	Y353C	probably damaging	Het
Vmn1r238	T	C	18: 3,123,305	I36M	probably benign	Het
Xylt1	T	A	7: 117,548,648	V149D	probably damaging	Het
Zfpm2	G	A	15: 41,102,959	E815K	probably benign	Het

Other mutations in Pes1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Pes1	APN	11	3976803	missense	probably damaging	1.00
IGL01448:Pes1	APN	11	3977979	missense	possibly damaging	0.89
H8441:Pes1	UTSW	11	3977636	small deletion	probably benign
R0634:Pes1	UTSW	11	3977794	splice site	probably benign
R0634:Pes1	UTSW	11	3977795	splice site	probably benign
R0883:Pes1	UTSW	11	3975557	missense	probably damaging	1.00
R0980:Pes1	UTSW	11	3977636	small deletion	probably benign
R1435:Pes1	UTSW	11	3976075	missense	probably benign	0.00
R1557:Pes1	UTSW	11	3976824	missense	probably damaging	1.00
R1694:Pes1	UTSW	11	3977719	small deletion	probably benign
R1885:Pes1	UTSW	11	3969482	missense	probably damaging	1.00
R1929:Pes1	UTSW	11	3969524	missense	probably damaging	1.00
R2270:Pes1	UTSW	11	3969524	missense	probably damaging	1.00
R2272:Pes1	UTSW	11	3969524	missense	probably damaging	1.00
R2362:Pes1	UTSW	11	3977123	missense	probably damaging	1.00
R2869:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R2869:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R2870:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R2870:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R2871:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R2871:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R2873:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R3039:Pes1	UTSW	11	3975547	missense	probably damaging	1.00
R3195:Pes1	UTSW	11	3975736	splice site	probably benign
R3773:Pes1	UTSW	11	3975548	missense	probably damaging	1.00
R4590:Pes1	UTSW	11	3977986	missense	probably damaging	1.00
R4739:Pes1	UTSW	11	3964058	missense	probably damaging	1.00
R5396:Pes1	UTSW	11	3977719	small deletion	probably benign
R6016:Pes1	UTSW	11	3978004	missense	possibly damaging	0.68
R6351:Pes1	UTSW	11	3978865	missense	probably benign
R6921:Pes1	UTSW	11	3973330	missense	probably damaging	0.98
R7315:Pes1	UTSW	11	3976085	missense	probably benign	0.00
R8178:Pes1	UTSW	11	3977718	missense	probably benign
R9599:Pes1	UTSW	11	3976118	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCATGTAAGCAGCAGAGGC -3'
(R):5'- CATGATGGCCAAGCGCTTAG -3'

Sequencing Primer
(F):5'- CAGAGGCAAGTTGGTGCTG -3'
(R):5'- TCCAGCTTCACAGTGCCG -3'

Posted On

2015-02-05