Incidental Mutation 'R3024:Trim41'
ID265778
Institutional Source Beutler Lab
Gene Symbol Trim41
Ensembl Gene ENSMUSG00000040365
Gene Nametripartite motif-containing 41
SynonymsRINCK
MMRRC Submission 040540-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R3024 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location48806404-48817353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48808158 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 420 (K420E)
Ref Sequence ENSEMBL: ENSMUSP00000037055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020640] [ENSMUST00000047145] [ENSMUST00000131888] [ENSMUST00000140800]
Predicted Effect probably benign
Transcript: ENSMUST00000020640
SMART Domains Protein: ENSMUSP00000020640
Gene: ENSMUSG00000020372

DomainStartEndE-ValueType
WD40 4 44 5.55e-7 SMART
WD40 52 91 6.48e-8 SMART
WD40 94 133 2.95e-11 SMART
WD40 135 178 8.55e-8 SMART
WD40 181 220 2.42e-7 SMART
WD40 223 260 6.34e-2 SMART
WD40 271 311 2.4e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000047145
AA Change: K420E

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037055
Gene: ENSMUSG00000040365
AA Change: K420E

DomainStartEndE-ValueType
RING 20 186 2.91e-6 SMART
BBOX 222 263 3.31e-10 SMART
coiled coil region 281 313 N/A INTRINSIC
coiled coil region 336 374 N/A INTRINSIC
PRY 430 482 2.04e-19 SMART
Pfam:SPRY 485 629 6.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125166
Predicted Effect probably benign
Transcript: ENSMUST00000131888
SMART Domains Protein: ENSMUSP00000119707
Gene: ENSMUSG00000040365

DomainStartEndE-ValueType
Pfam:DUF3631 9 124 9.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136849
Predicted Effect probably benign
Transcript: ENSMUST00000138019
SMART Domains Protein: ENSMUSP00000118789
Gene: ENSMUSG00000040365

DomainStartEndE-ValueType
Blast:RING 2 45 2e-6 BLAST
SCOP:d1jm7b_ 41 75 1e-4 SMART
BBOX 81 122 3.31e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139959
Predicted Effect probably benign
Transcript: ENSMUST00000140800
SMART Domains Protein: ENSMUSP00000121705
Gene: ENSMUSG00000040365

DomainStartEndE-ValueType
BBOX 19 60 3.31e-10 SMART
coiled coil region 78 110 N/A INTRINSIC
coiled coil region 133 161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142269
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM family is characterized by a signature motif composed of a RING finger, one or more B-box domains, and a coiled-coil region. This encoded protein may play a role in protein kinase C signaling. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef37 T C 18: 61,501,888 E461G probably damaging Het
Bfsp1 A T 2: 143,845,959 V182D probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Chil6 T C 3: 106,388,770 D383G probably damaging Het
Itpr2 G A 6: 146,180,310 A175V probably benign Het
Kcnh7 G T 2: 62,764,663 R688S probably damaging Het
Krt6a A T 15: 101,691,289 C463S probably benign Het
Ksr2 T A 5: 117,555,060 I191N possibly damaging Het
Lyst T C 13: 13,658,687 V1698A probably benign Het
Olfr103 A T 17: 37,337,027 D68E probably damaging Het
Olfr1262 A T 2: 90,003,240 N278I probably damaging Het
Pappa2 C T 1: 158,936,225 R572Q probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Phf20 A G 2: 156,287,867 H453R probably damaging Het
Prex1 G T 2: 166,589,036 H615Q probably benign Het
Slc25a54 T A 3: 109,080,666 I41N probably damaging Het
Slc35f5 A G 1: 125,568,598 S157G probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Tsnaxip1 A G 8: 105,841,743 Y353C probably damaging Het
Vmn1r238 T C 18: 3,123,305 I36M probably benign Het
Xylt1 T A 7: 117,548,648 V149D probably damaging Het
Zfpm2 G A 15: 41,102,959 E815K probably benign Het
Other mutations in Trim41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Trim41 APN 11 48812363 missense possibly damaging 0.94
IGL02959:Trim41 APN 11 48807480 missense probably damaging 1.00
R0692:Trim41 UTSW 11 48808250 unclassified probably null
R1785:Trim41 UTSW 11 48807592 missense probably damaging 1.00
R1931:Trim41 UTSW 11 48807492 missense probably damaging 0.99
R2130:Trim41 UTSW 11 48807592 missense probably damaging 1.00
R2132:Trim41 UTSW 11 48807592 missense probably damaging 1.00
R2918:Trim41 UTSW 11 48816257 intron probably benign
R3018:Trim41 UTSW 11 48807694 missense probably benign 0.00
R3770:Trim41 UTSW 11 48809084 missense possibly damaging 0.75
R5295:Trim41 UTSW 11 48816257 intron probably benign
R5615:Trim41 UTSW 11 48807365 unclassified probably benign
R5616:Trim41 UTSW 11 48807365 unclassified probably benign
R6673:Trim41 UTSW 11 48816257 intron probably benign
RF010:Trim41 UTSW 11 48807338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCCTAATTCTAACACCTGCTGG -3'
(R):5'- TCCCCAGAACCTAAGTTTCTGC -3'

Sequencing Primer
(F):5'- AACACCTGCTGGCCTGTC -3'
(R):5'- AGAACCTAAGTTTCTGCTTCTCAG -3'
Posted On2015-02-05