Mutagenetix > Incidental Mutation

Incidental Mutation 'R3024:Zfpm2'

265780

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

FOG2, B330005D23Rik, FOG-2

MMRRC Submission

040540-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3024 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40518438-40967988 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 40966355 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 815 (E815K)

Ref Sequence

ENSEMBL: ENSMUSP00000155094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

AlphaFold

Q8CCH7

Predicted Effect

probably benign
Transcript: ENSMUST00000053467
AA Change: E947K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: E947K

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000230319
AA Change: E815K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef37	T	C	18: 61,634,959 (GRCm39)	E461G	probably damaging	Het
Bfsp1	A	T	2: 143,687,879 (GRCm39)	V182D	probably benign	Het
Birc6	T	C	17: 74,915,214 (GRCm39)	S1635P	possibly damaging	Het
Chil6	T	C	3: 106,296,086 (GRCm39)	D383G	probably damaging	Het
Itpr2	G	A	6: 146,081,808 (GRCm39)	A175V	probably benign	Het
Kcnh7	G	T	2: 62,595,007 (GRCm39)	R688S	probably damaging	Het
Krt6a	A	T	15: 101,599,724 (GRCm39)	C463S	probably benign	Het
Ksr2	T	A	5: 117,693,125 (GRCm39)	I191N	possibly damaging	Het
Lyst	T	C	13: 13,833,272 (GRCm39)	V1698A	probably benign	Het
Or12d13	A	T	17: 37,647,918 (GRCm39)	D68E	probably damaging	Het
Or4c127	A	T	2: 89,833,584 (GRCm39)	N278I	probably damaging	Het
Pappa2	C	T	1: 158,763,795 (GRCm39)	R572Q	probably benign	Het
Pes1	CGGAGGAGGAGGAGGAGGAGGAGG	CGGAGGAGGAGGAGGAGGAGG	11: 3,927,719 (GRCm39)		probably benign	Het
Phf20	A	G	2: 156,129,787 (GRCm39)	H453R	probably damaging	Het
Prex1	G	T	2: 166,430,956 (GRCm39)	H615Q	probably benign	Het
Slc25a54	T	A	3: 108,987,982 (GRCm39)	I41N	probably damaging	Het
Slc35f5	A	G	1: 125,496,335 (GRCm39)	S157G	probably benign	Het
Sstr3	G	A	15: 78,424,187 (GRCm39)	R187W	probably damaging	Het
Trim41	T	C	11: 48,698,985 (GRCm39)	K420E	possibly damaging	Het
Tsnaxip1	A	G	8: 106,568,375 (GRCm39)	Y353C	probably damaging	Het
Vmn1r238	T	C	18: 3,123,305 (GRCm39)	I36M	probably benign	Het
Xylt1	T	A	7: 117,147,883 (GRCm39)	V149D	probably damaging	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	40,962,683 (GRCm39)	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	40,962,887 (GRCm39)	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	40,966,783 (GRCm39)	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	40,965,320 (GRCm39)	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	40,965,320 (GRCm39)	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40,616,452 (GRCm39)	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	40,965,783 (GRCm39)	missense	probably benign
IGL02087:Zfpm2	APN	15	40,966,517 (GRCm39)	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	40,965,591 (GRCm39)	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	40,962,890 (GRCm39)	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	40,962,890 (GRCm39)	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	40,962,868 (GRCm39)	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	40,965,415 (GRCm39)	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	40,966,409 (GRCm39)	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	40,966,662 (GRCm39)	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	40,964,790 (GRCm39)	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	40,966,170 (GRCm39)	missense	probably benign
R0305:Zfpm2	UTSW	15	40,637,431 (GRCm39)	splice site	probably benign
R0365:Zfpm2	UTSW	15	40,637,462 (GRCm39)	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	40,965,075 (GRCm39)	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	40,965,877 (GRCm39)	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	40,962,687 (GRCm39)	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	40,966,605 (GRCm39)	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	40,966,419 (GRCm39)	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	40,964,579 (GRCm39)	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	40,962,785 (GRCm39)	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	40,962,785 (GRCm39)	missense	probably benign	0.06
R2886:Zfpm2	UTSW	15	40,965,719 (GRCm39)	missense	probably benign	0.44
R4043:Zfpm2	UTSW	15	40,734,023 (GRCm39)	missense	possibly damaging	0.94
R4178:Zfpm2	UTSW	15	40,966,940 (GRCm39)	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	40,959,557 (GRCm39)	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	40,962,791 (GRCm39)	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	40,962,865 (GRCm39)	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40,733,938 (GRCm39)	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	40,965,933 (GRCm39)	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	40,959,467 (GRCm39)	nonsense	probably null
R6437:Zfpm2	UTSW	15	40,962,793 (GRCm39)	missense	probably benign
R6660:Zfpm2	UTSW	15	40,518,981 (GRCm39)	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	40,965,114 (GRCm39)	missense	probably benign
R6749:Zfpm2	UTSW	15	40,818,104 (GRCm39)	missense	possibly damaging	0.90
R7363:Zfpm2	UTSW	15	40,616,413 (GRCm39)	missense	probably damaging	1.00
R7401:Zfpm2	UTSW	15	40,966,386 (GRCm39)	missense	possibly damaging	0.87
R7657:Zfpm2	UTSW	15	40,966,671 (GRCm39)	missense	possibly damaging	0.78
R7690:Zfpm2	UTSW	15	40,818,162 (GRCm39)	missense	possibly damaging	0.45
R7698:Zfpm2	UTSW	15	40,959,487 (GRCm39)	missense	probably benign	0.03
R7893:Zfpm2	UTSW	15	40,966,008 (GRCm39)	missense	probably damaging	1.00
R8081:Zfpm2	UTSW	15	40,965,644 (GRCm39)	missense	probably damaging	1.00
R8223:Zfpm2	UTSW	15	40,616,355 (GRCm39)	missense	probably benign	0.34
R9028:Zfpm2	UTSW	15	40,966,758 (GRCm39)	missense	possibly damaging	0.87
R9065:Zfpm2	UTSW	15	40,962,712 (GRCm39)	missense	possibly damaging	0.95
R9234:Zfpm2	UTSW	15	40,966,470 (GRCm39)	missense	probably damaging	1.00
R9474:Zfpm2	UTSW	15	40,966,867 (GRCm39)	missense	probably damaging	1.00
R9694:Zfpm2	UTSW	15	40,965,710 (GRCm39)	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AGAACTATCTGGCGCACAAGC -3'
(R):5'- CGTCAGTGTTGTGGATGACAAG -3'

Sequencing Primer
(F):5'- TGTCACTGCACATCAGCGTAATG -3'
(R):5'- TCAGTGTTGTGGATGACAAGAGAAC -3'

Posted On

2015-02-05