Incidental Mutation 'R3024:Krt6a'
List |< first << previous [record 7 of 23] next >> last >|
ID265782
Institutional Source Beutler Lab
Gene Symbol Krt6a
Ensembl Gene ENSMUSG00000058354
Gene Namekeratin 6A
SynonymsKrt2-6a, MK6a, mK6[a], Krt2-6c
MMRRC Submission 040540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R3024 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101689910-101694307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101691289 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 463 (C463S)
Ref Sequence ENSEMBL: ENSMUSP00000023788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023788]
Predicted Effect probably benign
Transcript: ENSMUST00000023788
AA Change: C463S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023788
Gene: ENSMUSG00000058354
AA Change: C463S

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 4.1e-36 PFAM
Filament 151 464 7.2e-178 SMART
low complexity region 483 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230205
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit delayed wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef37 T C 18: 61,501,888 E461G probably damaging Het
Bfsp1 A T 2: 143,845,959 V182D probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Chil6 T C 3: 106,388,770 D383G probably damaging Het
Itpr2 G A 6: 146,180,310 A175V probably benign Het
Kcnh7 G T 2: 62,764,663 R688S probably damaging Het
Ksr2 T A 5: 117,555,060 I191N possibly damaging Het
Lyst T C 13: 13,658,687 V1698A probably benign Het
Olfr103 A T 17: 37,337,027 D68E probably damaging Het
Olfr1262 A T 2: 90,003,240 N278I probably damaging Het
Pappa2 C T 1: 158,936,225 R572Q probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Phf20 A G 2: 156,287,867 H453R probably damaging Het
Prex1 G T 2: 166,589,036 H615Q probably benign Het
Slc25a54 T A 3: 109,080,666 I41N probably damaging Het
Slc35f5 A G 1: 125,568,598 S157G probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Trim41 T C 11: 48,808,158 K420E possibly damaging Het
Tsnaxip1 A G 8: 105,841,743 Y353C probably damaging Het
Vmn1r238 T C 18: 3,123,305 I36M probably benign Het
Xylt1 T A 7: 117,548,648 V149D probably damaging Het
Zfpm2 G A 15: 41,102,959 E815K probably benign Het
Other mutations in Krt6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Krt6a APN 15 101692794 missense probably damaging 1.00
IGL00596:Krt6a APN 15 101694230 missense possibly damaging 0.53
PIT4468001:Krt6a UTSW 15 101693917 missense probably damaging 0.98
R0024:Krt6a UTSW 15 101690715 splice site probably benign
R0024:Krt6a UTSW 15 101690715 splice site probably benign
R0811:Krt6a UTSW 15 101692748 missense probably damaging 1.00
R0812:Krt6a UTSW 15 101692748 missense probably damaging 1.00
R0828:Krt6a UTSW 15 101693836 missense probably damaging 0.99
R0924:Krt6a UTSW 15 101690800 splice site probably benign
R1525:Krt6a UTSW 15 101694202 missense probably benign
R1591:Krt6a UTSW 15 101692357 splice site probably null
R1725:Krt6a UTSW 15 101692557 missense probably damaging 1.00
R1962:Krt6a UTSW 15 101691465 missense probably damaging 1.00
R2201:Krt6a UTSW 15 101693171 missense probably benign 0.41
R3158:Krt6a UTSW 15 101691366 missense probably damaging 1.00
R5369:Krt6a UTSW 15 101692558 missense probably benign 0.06
R5637:Krt6a UTSW 15 101692279 missense probably benign 0.25
R6164:Krt6a UTSW 15 101692573 missense probably damaging 0.99
R6320:Krt6a UTSW 15 101692309 missense probably damaging 0.99
R6562:Krt6a UTSW 15 101691659 missense probably benign 0.36
R7267:Krt6a UTSW 15 101693854 missense probably benign 0.03
R7560:Krt6a UTSW 15 101690559 missense unknown
R7621:Krt6a UTSW 15 101691752 missense possibly damaging 0.92
R7671:Krt6a UTSW 15 101690543 missense unknown
R8017:Krt6a UTSW 15 101693869 missense probably damaging 1.00
R8019:Krt6a UTSW 15 101693869 missense probably damaging 1.00
R8318:Krt6a UTSW 15 101694247 start codon destroyed probably null 0.02
X0067:Krt6a UTSW 15 101693777 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCTCAGAGAGAATCCACTAGAG -3'
(R):5'- AGCTGCTATTGCTGATGCTG -3'

Sequencing Primer
(F):5'- CTGTAGCTGTTTTCAAACACACCAG -3'
(R):5'- TGCTGATGCTGAGCAACG -3'
Posted On2015-02-05