Incidental Mutation 'R3024:Olfr103'
ID265783
Institutional Source Beutler Lab
Gene Symbol Olfr103
Ensembl Gene ENSMUSG00000049618
Gene Nameolfactory receptor 103
SynonymsMOR250-3, GA_x6K02T2PSCP-1798423-1797482, MOR250-8_p
MMRRC Submission 040540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3024 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37334303-37339698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37337027 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 68 (D68E)
Ref Sequence ENSEMBL: ENSMUSP00000134539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058826] [ENSMUST00000173472]
Predicted Effect probably damaging
Transcript: ENSMUST00000058826
AA Change: D68E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094934
Gene: ENSMUSG00000049618
AA Change: D68E

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 3.5e-52 PFAM
Pfam:7tm_1 39 289 3.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173472
AA Change: D68E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134539
Gene: ENSMUSG00000049618
AA Change: D68E

DomainStartEndE-ValueType
Pfam:7tm_1 39 289 2.8e-31 PFAM
Pfam:7tm_4 137 282 1.1e-38 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef37 T C 18: 61,501,888 E461G probably damaging Het
Bfsp1 A T 2: 143,845,959 V182D probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Chil6 T C 3: 106,388,770 D383G probably damaging Het
Itpr2 G A 6: 146,180,310 A175V probably benign Het
Kcnh7 G T 2: 62,764,663 R688S probably damaging Het
Krt6a A T 15: 101,691,289 C463S probably benign Het
Ksr2 T A 5: 117,555,060 I191N possibly damaging Het
Lyst T C 13: 13,658,687 V1698A probably benign Het
Olfr1262 A T 2: 90,003,240 N278I probably damaging Het
Pappa2 C T 1: 158,936,225 R572Q probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Phf20 A G 2: 156,287,867 H453R probably damaging Het
Prex1 G T 2: 166,589,036 H615Q probably benign Het
Slc25a54 T A 3: 109,080,666 I41N probably damaging Het
Slc35f5 A G 1: 125,568,598 S157G probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Trim41 T C 11: 48,808,158 K420E possibly damaging Het
Tsnaxip1 A G 8: 105,841,743 Y353C probably damaging Het
Vmn1r238 T C 18: 3,123,305 I36M probably benign Het
Xylt1 T A 7: 117,548,648 V149D probably damaging Het
Zfpm2 G A 15: 41,102,959 E815K probably benign Het
Other mutations in Olfr103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Olfr103 APN 17 37336583 nonsense probably null
IGL01953:Olfr103 APN 17 37336875 missense probably damaging 1.00
IGL02556:Olfr103 APN 17 37336996 missense probably benign 0.00
IGL02574:Olfr103 APN 17 37336524 missense probably damaging 1.00
IGL02737:Olfr103 APN 17 37336773 missense possibly damaging 0.94
IGL02995:Olfr103 APN 17 37336709 missense probably damaging 1.00
R1078:Olfr103 UTSW 17 37337026 missense probably damaging 0.98
R1466:Olfr103 UTSW 17 37336956 missense probably benign 0.43
R1466:Olfr103 UTSW 17 37336956 missense probably benign 0.43
R3858:Olfr103 UTSW 17 37337226 nonsense probably null
R4979:Olfr103 UTSW 17 37336868 missense probably benign 0.06
R5062:Olfr103 UTSW 17 37336931 missense probably damaging 0.99
R5215:Olfr103 UTSW 17 37336813 missense probably benign 0.00
R5441:Olfr103 UTSW 17 37336268 unclassified probably null
R5453:Olfr103 UTSW 17 37337062 missense possibly damaging 0.96
R5525:Olfr103 UTSW 17 37336626 missense probably damaging 0.99
R5660:Olfr103 UTSW 17 37336644 missense probably damaging 1.00
R5859:Olfr103 UTSW 17 37336369 missense possibly damaging 0.61
R6211:Olfr103 UTSW 17 37336708 missense possibly damaging 0.90
R6958:Olfr103 UTSW 17 37336417 missense probably benign
R7060:Olfr103 UTSW 17 37336461 missense probably benign 0.02
R7567:Olfr103 UTSW 17 37337171 missense probably benign 0.00
R7784:Olfr103 UTSW 17 37336578 missense probably benign 0.13
R7784:Olfr103 UTSW 17 37337055 missense probably damaging 0.99
Z1088:Olfr103 UTSW 17 37336705 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGCAGATAGCCACAAAGC -3'
(R):5'- TCGACAAACTATGCTGTGTTTC -3'

Sequencing Primer
(F):5'- GCGGTCAAATGCCATCACTG -3'
(R):5'- GGTGATGTTGAATCAAACCTCTGTC -3'
Posted On2015-02-05