Incidental Mutation 'R3024:Arhgef37'
ID265786
Institutional Source Beutler Lab
Gene Symbol Arhgef37
Ensembl Gene ENSMUSG00000045094
Gene NameRho guanine nucleotide exchange factor (GEF) 37
Synonyms4933429F08Rik
MMRRC Submission 040540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R3024 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61493794-61536536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61501888 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 461 (E461G)
Ref Sequence ENSEMBL: ENSMUSP00000130560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171629]
Predicted Effect probably damaging
Transcript: ENSMUST00000171629
AA Change: E461G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130560
Gene: ENSMUSG00000045094
AA Change: E461G

DomainStartEndE-ValueType
RhoGEF 34 212 2.62e-35 SMART
Pfam:BAR 311 444 5.6e-10 PFAM
SH3 509 568 8.06e-1 SMART
SH3 606 665 2.56e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bfsp1 A T 2: 143,845,959 V182D probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Chil6 T C 3: 106,388,770 D383G probably damaging Het
Itpr2 G A 6: 146,180,310 A175V probably benign Het
Kcnh7 G T 2: 62,764,663 R688S probably damaging Het
Krt6a A T 15: 101,691,289 C463S probably benign Het
Ksr2 T A 5: 117,555,060 I191N possibly damaging Het
Lyst T C 13: 13,658,687 V1698A probably benign Het
Olfr103 A T 17: 37,337,027 D68E probably damaging Het
Olfr1262 A T 2: 90,003,240 N278I probably damaging Het
Pappa2 C T 1: 158,936,225 R572Q probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Phf20 A G 2: 156,287,867 H453R probably damaging Het
Prex1 G T 2: 166,589,036 H615Q probably benign Het
Slc25a54 T A 3: 109,080,666 I41N probably damaging Het
Slc35f5 A G 1: 125,568,598 S157G probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Trim41 T C 11: 48,808,158 K420E possibly damaging Het
Tsnaxip1 A G 8: 105,841,743 Y353C probably damaging Het
Vmn1r238 T C 18: 3,123,305 I36M probably benign Het
Xylt1 T A 7: 117,548,648 V149D probably damaging Het
Zfpm2 G A 15: 41,102,959 E815K probably benign Het
Other mutations in Arhgef37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Arhgef37 APN 18 61523871 missense probably damaging 1.00
IGL00801:Arhgef37 APN 18 61499834 missense probably damaging 1.00
IGL01146:Arhgef37 APN 18 61518010 missense possibly damaging 0.93
IGL02052:Arhgef37 APN 18 61499768 missense probably damaging 1.00
IGL02489:Arhgef37 APN 18 61506469 missense possibly damaging 0.91
IGL03236:Arhgef37 APN 18 61523826 missense probably damaging 1.00
R0715:Arhgef37 UTSW 18 61508789 missense probably damaging 0.98
R0746:Arhgef37 UTSW 18 61517993 critical splice donor site probably null
R1843:Arhgef37 UTSW 18 61518050 missense probably damaging 0.99
R1934:Arhgef37 UTSW 18 61523943 missense probably benign 0.00
R1980:Arhgef37 UTSW 18 61508696 missense probably damaging 0.98
R2012:Arhgef37 UTSW 18 61504356 missense possibly damaging 0.56
R2237:Arhgef37 UTSW 18 61504406 missense probably damaging 1.00
R4864:Arhgef37 UTSW 18 61494925 missense probably benign
R4876:Arhgef37 UTSW 18 61498239 nonsense probably null
R5024:Arhgef37 UTSW 18 61506440 missense probably damaging 0.99
R5050:Arhgef37 UTSW 18 61504331 missense probably benign 0.43
R5512:Arhgef37 UTSW 18 61499774 nonsense probably null
R5611:Arhgef37 UTSW 18 61507263 missense probably benign 0.03
R6051:Arhgef37 UTSW 18 61507274 missense probably damaging 0.97
R6488:Arhgef37 UTSW 18 61518052 missense probably benign 0.43
R6612:Arhgef37 UTSW 18 61494881 missense probably benign
R7117:Arhgef37 UTSW 18 61504410 missense probably benign 0.00
R7351:Arhgef37 UTSW 18 61498215 missense possibly damaging 0.93
R7426:Arhgef37 UTSW 18 61504385 missense probably damaging 1.00
R7571:Arhgef37 UTSW 18 61504332 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGGAAGCTTCAGCACACTG -3'
(R):5'- CTTCCCCTATGGAGAGATGTTTTC -3'

Sequencing Primer
(F):5'- TTGTGCAGGAGAGCGGC -3'
(R):5'- CCCCTATGGAGAGATGTTTTCTTAAC -3'
Posted On2015-02-05