Incidental Mutation 'R3025:Kcnb2'
ID265788
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Namepotassium voltage gated channel, Shab-related subfamily, member 2
Synonyms9630047L19Rik, Kv2.2
MMRRC Submission 040541-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3025 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location15287254-15723750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 15710835 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 644 (Q644K)
Ref Sequence ENSEMBL: ENSMUSP00000135382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170146
AA Change: Q644K

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000175681
AA Change: Q644K

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: Q644K

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,974,093 probably null Het
Akap6 A G 12: 53,140,143 T1447A probably benign Het
Atp13a2 C T 4: 140,994,348 R250C probably damaging Het
Cacna1a T A 8: 84,580,225 probably null Het
Chd6 GATCAT GAT 2: 160,966,552 probably benign Het
Cptp T C 4: 155,867,221 E5G possibly damaging Het
Dnajc16 C A 4: 141,774,611 V303F probably benign Het
Gm10842 T C 11: 105,147,076 S62P unknown Het
Gm17509 T C 13: 117,220,576 probably benign Het
Homer1 C T 13: 93,402,074 Q142* probably null Het
Map3k19 T C 1: 127,838,553 probably null Het
Msh4 T A 3: 153,863,491 H621L probably damaging Het
Ogfod1 A T 8: 94,063,052 E460D probably damaging Het
Olfr228 A T 2: 86,483,739 M1K probably null Het
Olfr808 T A 10: 129,767,673 F59Y probably damaging Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Scaf4 A T 16: 90,251,938 H329Q unknown Het
Sec61a1 A T 6: 88,512,220 D166E probably damaging Het
Tars2 C T 3: 95,747,640 R63H possibly damaging Het
Vmn1r57 A T 7: 5,220,715 K80* probably null Het
Vmn2r106 A G 17: 20,278,885 W255R probably benign Het
Wdr49 C G 3: 75,333,356 C402S possibly damaging Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15711012 missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15312923 missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15710824 missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15312954 missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15710809 missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15709861 missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15710935 missense probably benign
IGL02526:Kcnb2 APN 1 15710755 missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15710506 missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15711211 missense probably benign
IGL03144:Kcnb2 APN 1 15709888 missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15312976 missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15712913 unclassified probably benign
R0538:Kcnb2 UTSW 1 15712884 unclassified probably benign
R0611:Kcnb2 UTSW 1 15710440 missense probably benign 0.07
R1542:Kcnb2 UTSW 1 15710788 missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15709755 missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15709766 missense possibly damaging 0.66
R2166:Kcnb2 UTSW 1 15711316 missense possibly damaging 0.82
R2444:Kcnb2 UTSW 1 15709567 missense probably benign
R3886:Kcnb2 UTSW 1 15710415 missense probably damaging 1.00
R5010:Kcnb2 UTSW 1 15312962 missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15709500 missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15710844 missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15711492 missense probably benign
R5926:Kcnb2 UTSW 1 15313011 missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15710566 missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15711212 missense probably benign
R6724:Kcnb2 UTSW 1 15710440 missense probably damaging 1.00
R6981:Kcnb2 UTSW 1 15710256 missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15312926 missense probably benign
R7352:Kcnb2 UTSW 1 15710611 missense probably benign
R7419:Kcnb2 UTSW 1 15711027 missense possibly damaging 0.94
R7425:Kcnb2 UTSW 1 15709807 missense probably damaging 1.00
R7606:Kcnb2 UTSW 1 15312840 missense probably damaging 1.00
R7978:Kcnb2 UTSW 1 15710613 missense probably benign 0.15
R7983:Kcnb2 UTSW 1 15312780 missense probably damaging 0.98
R8115:Kcnb2 UTSW 1 15711627 makesense probably null
R8156:Kcnb2 UTSW 1 15710056 missense probably damaging 1.00
R8408:Kcnb2 UTSW 1 15711553 missense probably damaging 1.00
R8439:Kcnb2 UTSW 1 15312710 missense probably damaging 1.00
R8726:Kcnb2 UTSW 1 15710652 missense probably benign 0.00
R8738:Kcnb2 UTSW 1 15710424 missense probably benign 0.07
V7580:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15710091 missense probably benign 0.03
Z1088:Kcnb2 UTSW 1 15711028 missense probably benign 0.01
Z1177:Kcnb2 UTSW 1 15710958 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCTGAGAGGCCATGTGTGTATG -3'
(R):5'- TTTCAGCGAGCTCTTAGGGC -3'

Sequencing Primer
(F):5'- AGAGGTGATCTGCCCACAG -3'
(R):5'- AGCTCTTAGGGCTGTCGC -3'
Posted On2015-02-05