Mutagenetix > Incidental Mutation

Incidental Mutation 'R3025:Map3k19'

265789

Institutional Source

Beutler Lab

Gene Symbol

Map3k19

Ensembl Gene

ENSMUSG00000051590

Gene Name

mitogen-activated protein kinase kinase kinase 19

Synonyms

Ysk4

MMRRC Submission

040541-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R3025 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

127815253-127855031 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 127838553 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061512] [ENSMUST00000061512] [ENSMUST00000208183] [ENSMUST00000208183]

AlphaFold

E9Q3S4

Predicted Effect

probably null
Transcript: ENSMUST00000061512

SMART Domains

Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
low complexity region	232	248	N/A	INTRINSIC
low complexity region	952	964	N/A	INTRINSIC
S_TKc	1044	1307	3.18e-90	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000061512

SMART Domains

Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
low complexity region	232	248	N/A	INTRINSIC
low complexity region	952	964	N/A	INTRINSIC
S_TKc	1044	1307	3.18e-90	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000187653

SMART Domains

Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
low complexity region	121	137	N/A	INTRINSIC
low complexity region	841	853	N/A	INTRINSIC
S_TKc	933	1196	1.5e-92	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000187653

SMART Domains

Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
low complexity region	121	137	N/A	INTRINSIC
low complexity region	841	853	N/A	INTRINSIC
S_TKc	933	1196	1.5e-92	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000189398

SMART Domains

Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
S_TKc	216	452	4.8e-15	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000189398

SMART Domains

Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
S_TKc	216	452	4.8e-15	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000191333

SMART Domains

Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
S_TKc	237	500	1.5e-92	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000191333

SMART Domains

Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
S_TKc	237	500	1.5e-92	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000208183

Predicted Effect

probably null
Transcript: ENSMUST00000208183

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	T	A	11: 105,974,093		probably null	Het
Akap6	A	G	12: 53,140,143	T1447A	probably benign	Het
Atp13a2	C	T	4: 140,994,348	R250C	probably damaging	Het
Cacna1a	T	A	8: 84,580,225		probably null	Het
Chd6	GATCAT	GAT	2: 160,966,552		probably benign	Het
Cptp	T	C	4: 155,867,221	E5G	possibly damaging	Het
Dnajc16	C	A	4: 141,774,611	V303F	probably benign	Het
Gm10842	T	C	11: 105,147,076	S62P	unknown	Het
Gm17509	T	C	13: 117,220,576		probably benign	Het
Homer1	C	T	13: 93,402,074	Q142*	probably null	Het
Kcnb2	C	A	1: 15,710,835	Q644K	possibly damaging	Het
Msh4	T	A	3: 153,863,491	H621L	probably damaging	Het
Ogfod1	A	T	8: 94,063,052	E460D	probably damaging	Het
Olfr228	A	T	2: 86,483,739	M1K	probably null	Het
Olfr808	T	A	10: 129,767,673	F59Y	probably damaging	Het
Rp1	G	A	1: 4,352,675	R61W	probably damaging	Het
Scaf4	A	T	16: 90,251,938	H329Q	unknown	Het
Sec61a1	A	T	6: 88,512,220	D166E	probably damaging	Het
Tars2	C	T	3: 95,747,640	R63H	possibly damaging	Het
Vmn1r57	A	T	7: 5,220,715	K80*	probably null	Het
Vmn2r106	A	G	17: 20,278,885	W255R	probably benign	Het
Wdr49	C	G	3: 75,333,356	C402S	possibly damaging	Het

Other mutations in Map3k19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01126:Map3k19	APN	1	127824331	nonsense	probably null
IGL01367:Map3k19	APN	1	127824351	missense	possibly damaging	0.88
IGL01443:Map3k19	APN	1	127838507	missense	probably benign	0.38
IGL01481:Map3k19	APN	1	127822478	missense	probably damaging	0.99
IGL01530:Map3k19	APN	1	127822104	missense	probably damaging	1.00
IGL01603:Map3k19	APN	1	127830273	missense	possibly damaging	0.89
IGL02044:Map3k19	APN	1	127823505	missense	probably damaging	1.00
IGL02159:Map3k19	APN	1	127823170	missense	probably benign	0.00
IGL02296:Map3k19	APN	1	127824246	missense	probably damaging	1.00
IGL02349:Map3k19	APN	1	127823769	missense	possibly damaging	0.48
IGL02823:Map3k19	APN	1	127822264	missense	probably benign	0.01
IGL02965:Map3k19	APN	1	127824066	missense	probably damaging	0.98
IGL03137:Map3k19	APN	1	127824315	missense	probably benign	0.04
R0125:Map3k19	UTSW	1	127823100	missense	probably benign	0.07
R0265:Map3k19	UTSW	1	127822182	missense	possibly damaging	0.61
R0389:Map3k19	UTSW	1	127822415	missense	probably benign	0.08
R0443:Map3k19	UTSW	1	127822415	missense	probably benign	0.08
R0465:Map3k19	UTSW	1	127838527	missense	probably damaging	1.00
R0645:Map3k19	UTSW	1	127822182	missense	possibly damaging	0.61
R0759:Map3k19	UTSW	1	127817425	missense	possibly damaging	0.90
R0815:Map3k19	UTSW	1	127834638	splice site	probably benign
R0838:Map3k19	UTSW	1	127823959	missense	probably benign	0.13
R1173:Map3k19	UTSW	1	127823880	missense	probably benign	0.17
R1174:Map3k19	UTSW	1	127823880	missense	probably benign	0.17
R1175:Map3k19	UTSW	1	127823880	missense	probably benign	0.17
R1457:Map3k19	UTSW	1	127817898	missense	probably damaging	1.00
R1661:Map3k19	UTSW	1	127817656	missense	possibly damaging	0.95
R1665:Map3k19	UTSW	1	127817656	missense	possibly damaging	0.95
R1753:Map3k19	UTSW	1	127822680	missense	probably benign	0.02
R1944:Map3k19	UTSW	1	127823122	missense	probably benign	0.29
R2496:Map3k19	UTSW	1	127823086	missense	probably damaging	1.00
R2878:Map3k19	UTSW	1	127823793	missense	possibly damaging	0.61
R2895:Map3k19	UTSW	1	127822098	missense	possibly damaging	0.60
R4577:Map3k19	UTSW	1	127822813	nonsense	probably null
R4612:Map3k19	UTSW	1	127815300	missense	probably benign	0.07
R4888:Map3k19	UTSW	1	127817733	missense	probably damaging	1.00
R4927:Map3k19	UTSW	1	127822195	missense	probably benign	0.08
R5028:Map3k19	UTSW	1	127823232	missense	probably benign	0.00
R5050:Map3k19	UTSW	1	127823562	missense	probably benign	0.21
R5131:Map3k19	UTSW	1	127823690	missense	possibly damaging	0.78
R5556:Map3k19	UTSW	1	127834547	nonsense	probably null
R5606:Map3k19	UTSW	1	127822957	missense	probably benign
R5617:Map3k19	UTSW	1	127822966	missense	probably damaging	1.00
R5755:Map3k19	UTSW	1	127822381	missense	probably benign	0.02
R5854:Map3k19	UTSW	1	127830355	missense	probably damaging	0.96
R5952:Map3k19	UTSW	1	127822740	missense	probably benign	0.01
R6132:Map3k19	UTSW	1	127850476	missense	possibly damaging	0.53
R6175:Map3k19	UTSW	1	127822832	missense	probably benign	0.05
R6261:Map3k19	UTSW	1	127822599	missense	possibly damaging	0.95
R6471:Map3k19	UTSW	1	127817254	missense	probably damaging	1.00
R6726:Map3k19	UTSW	1	127820448	missense	probably benign	0.09
R6732:Map3k19	UTSW	1	127824232	missense	probably benign	0.37
R6762:Map3k19	UTSW	1	127847264	missense	probably damaging	1.00
R7366:Map3k19	UTSW	1	127817455	missense	probably damaging	1.00
R7414:Map3k19	UTSW	1	127838452	missense	probably damaging	0.99
R7686:Map3k19	UTSW	1	127822248	nonsense	probably null
R7702:Map3k19	UTSW	1	127829090	missense	probably damaging	1.00
R7849:Map3k19	UTSW	1	127823646	missense	probably benign	0.21
R8129:Map3k19	UTSW	1	127822683	missense	possibly damaging	0.90
R8134:Map3k19	UTSW	1	127823755	missense	probably damaging	0.99
R8136:Map3k19	UTSW	1	127823755	missense	probably damaging	0.99
R8264:Map3k19	UTSW	1	127823791	missense
R8305:Map3k19	UTSW	1	127817270	missense
R8511:Map3k19	UTSW	1	127847418	missense	possibly damaging	0.71
R8808:Map3k19	UTSW	1	127824129	missense	probably damaging	1.00
R8913:Map3k19	UTSW	1	127822626	missense	probably benign	0.08
R9025:Map3k19	UTSW	1	127830438	missense	probably benign	0.06
R9593:Map3k19	UTSW	1	127850426	missense	probably benign	0.01
R9681:Map3k19	UTSW	1	127822360	missense	possibly damaging	0.61
Z1177:Map3k19	UTSW	1	127822034	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- AAATAGTAGGTTGACCAGACATTTC -3'
(R):5'- GAATGACGTCATTAAGGATGAGTTG -3'

Sequencing Primer
(F):5'- TATCATGCCGATGCTGGGAAC -3'
(R):5'- GTGGTGCATGTACATGCA -3'

Posted On

2015-02-05