Incidental Mutation 'R3025:Map3k19'
ID 265789
Institutional Source Beutler Lab
Gene Symbol Map3k19
Ensembl Gene ENSMUSG00000051590
Gene Name mitogen-activated protein kinase kinase kinase 19
Synonyms Ysk4
MMRRC Submission 040541-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R3025 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 127742528-127782768 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to C at 127766290 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061512] [ENSMUST00000061512] [ENSMUST00000208183] [ENSMUST00000208183]
AlphaFold E9Q3S4
Predicted Effect probably null
Transcript: ENSMUST00000061512
SMART Domains Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
S_TKc 1044 1307 3.18e-90 SMART
Predicted Effect probably null
Transcript: ENSMUST00000061512
SMART Domains Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
S_TKc 1044 1307 3.18e-90 SMART
Predicted Effect probably null
Transcript: ENSMUST00000187653
SMART Domains Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
S_TKc 933 1196 1.5e-92 SMART
Predicted Effect probably null
Transcript: ENSMUST00000187653
SMART Domains Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
S_TKc 933 1196 1.5e-92 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189398
SMART Domains Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 216 452 4.8e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189398
SMART Domains Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 216 452 4.8e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191333
SMART Domains Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 237 500 1.5e-92 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191333
SMART Domains Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 237 500 1.5e-92 SMART
Predicted Effect probably null
Transcript: ENSMUST00000208183
Predicted Effect probably null
Transcript: ENSMUST00000208183
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,864,919 (GRCm39) probably null Het
Akap6 A G 12: 53,186,926 (GRCm39) T1447A probably benign Het
Atp13a2 C T 4: 140,721,659 (GRCm39) R250C probably damaging Het
Cacna1a T A 8: 85,306,854 (GRCm39) probably null Het
Chd6 GATCAT GAT 2: 160,808,472 (GRCm39) probably benign Het
Cptp T C 4: 155,951,678 (GRCm39) E5G possibly damaging Het
Dnajc16 C A 4: 141,501,922 (GRCm39) V303F probably benign Het
Gm10842 T C 11: 105,037,902 (GRCm39) S62P unknown Het
Gm17509 T C 13: 117,357,112 (GRCm39) probably benign Het
Homer1 C T 13: 93,538,582 (GRCm39) Q142* probably null Het
Kcnb2 C A 1: 15,781,059 (GRCm39) Q644K possibly damaging Het
Msh4 T A 3: 153,569,128 (GRCm39) H621L probably damaging Het
Ogfod1 A T 8: 94,789,680 (GRCm39) E460D probably damaging Het
Or6c65 T A 10: 129,603,542 (GRCm39) F59Y probably damaging Het
Or8k41 A T 2: 86,314,083 (GRCm39) M1K probably null Het
Rp1 G A 1: 4,422,898 (GRCm39) R61W probably damaging Het
Scaf4 A T 16: 90,048,826 (GRCm39) H329Q unknown Het
Sec61a1 A T 6: 88,489,202 (GRCm39) D166E probably damaging Het
Tars2 C T 3: 95,654,952 (GRCm39) R63H possibly damaging Het
Vmn1r57 A T 7: 5,223,714 (GRCm39) K80* probably null Het
Vmn2r106 A G 17: 20,499,147 (GRCm39) W255R probably benign Het
Wdr49 C G 3: 75,240,663 (GRCm39) C402S possibly damaging Het
Other mutations in Map3k19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Map3k19 APN 1 127,752,068 (GRCm39) nonsense probably null
IGL01367:Map3k19 APN 1 127,752,088 (GRCm39) missense possibly damaging 0.88
IGL01443:Map3k19 APN 1 127,766,244 (GRCm39) missense probably benign 0.38
IGL01481:Map3k19 APN 1 127,750,215 (GRCm39) missense probably damaging 0.99
IGL01530:Map3k19 APN 1 127,749,841 (GRCm39) missense probably damaging 1.00
IGL01603:Map3k19 APN 1 127,758,010 (GRCm39) missense possibly damaging 0.89
IGL02044:Map3k19 APN 1 127,751,242 (GRCm39) missense probably damaging 1.00
IGL02159:Map3k19 APN 1 127,750,907 (GRCm39) missense probably benign 0.00
IGL02296:Map3k19 APN 1 127,751,983 (GRCm39) missense probably damaging 1.00
IGL02349:Map3k19 APN 1 127,751,506 (GRCm39) missense possibly damaging 0.48
IGL02823:Map3k19 APN 1 127,750,001 (GRCm39) missense probably benign 0.01
IGL02965:Map3k19 APN 1 127,751,803 (GRCm39) missense probably damaging 0.98
IGL03137:Map3k19 APN 1 127,752,052 (GRCm39) missense probably benign 0.04
R0125:Map3k19 UTSW 1 127,750,837 (GRCm39) missense probably benign 0.07
R0265:Map3k19 UTSW 1 127,749,919 (GRCm39) missense possibly damaging 0.61
R0389:Map3k19 UTSW 1 127,750,152 (GRCm39) missense probably benign 0.08
R0443:Map3k19 UTSW 1 127,750,152 (GRCm39) missense probably benign 0.08
R0465:Map3k19 UTSW 1 127,766,264 (GRCm39) missense probably damaging 1.00
R0645:Map3k19 UTSW 1 127,749,919 (GRCm39) missense possibly damaging 0.61
R0759:Map3k19 UTSW 1 127,745,162 (GRCm39) missense possibly damaging 0.90
R0815:Map3k19 UTSW 1 127,762,375 (GRCm39) splice site probably benign
R0838:Map3k19 UTSW 1 127,751,696 (GRCm39) missense probably benign 0.13
R1173:Map3k19 UTSW 1 127,751,617 (GRCm39) missense probably benign 0.17
R1174:Map3k19 UTSW 1 127,751,617 (GRCm39) missense probably benign 0.17
R1175:Map3k19 UTSW 1 127,751,617 (GRCm39) missense probably benign 0.17
R1457:Map3k19 UTSW 1 127,745,635 (GRCm39) missense probably damaging 1.00
R1661:Map3k19 UTSW 1 127,745,393 (GRCm39) missense possibly damaging 0.95
R1665:Map3k19 UTSW 1 127,745,393 (GRCm39) missense possibly damaging 0.95
R1753:Map3k19 UTSW 1 127,750,417 (GRCm39) missense probably benign 0.02
R1944:Map3k19 UTSW 1 127,750,859 (GRCm39) missense probably benign 0.29
R2496:Map3k19 UTSW 1 127,750,823 (GRCm39) missense probably damaging 1.00
R2878:Map3k19 UTSW 1 127,751,530 (GRCm39) missense possibly damaging 0.61
R2895:Map3k19 UTSW 1 127,749,835 (GRCm39) missense possibly damaging 0.60
R4577:Map3k19 UTSW 1 127,750,550 (GRCm39) nonsense probably null
R4612:Map3k19 UTSW 1 127,743,037 (GRCm39) missense probably benign 0.07
R4888:Map3k19 UTSW 1 127,745,470 (GRCm39) missense probably damaging 1.00
R4927:Map3k19 UTSW 1 127,749,932 (GRCm39) missense probably benign 0.08
R5028:Map3k19 UTSW 1 127,750,969 (GRCm39) missense probably benign 0.00
R5050:Map3k19 UTSW 1 127,751,299 (GRCm39) missense probably benign 0.21
R5131:Map3k19 UTSW 1 127,751,427 (GRCm39) missense possibly damaging 0.78
R5556:Map3k19 UTSW 1 127,762,284 (GRCm39) nonsense probably null
R5606:Map3k19 UTSW 1 127,750,694 (GRCm39) missense probably benign
R5617:Map3k19 UTSW 1 127,750,703 (GRCm39) missense probably damaging 1.00
R5755:Map3k19 UTSW 1 127,750,118 (GRCm39) missense probably benign 0.02
R5854:Map3k19 UTSW 1 127,758,092 (GRCm39) missense probably damaging 0.96
R5952:Map3k19 UTSW 1 127,750,477 (GRCm39) missense probably benign 0.01
R6132:Map3k19 UTSW 1 127,778,213 (GRCm39) missense possibly damaging 0.53
R6175:Map3k19 UTSW 1 127,750,569 (GRCm39) missense probably benign 0.05
R6261:Map3k19 UTSW 1 127,750,336 (GRCm39) missense possibly damaging 0.95
R6471:Map3k19 UTSW 1 127,744,991 (GRCm39) missense probably damaging 1.00
R6726:Map3k19 UTSW 1 127,748,185 (GRCm39) missense probably benign 0.09
R6732:Map3k19 UTSW 1 127,751,969 (GRCm39) missense probably benign 0.37
R6762:Map3k19 UTSW 1 127,775,001 (GRCm39) missense probably damaging 1.00
R7366:Map3k19 UTSW 1 127,745,192 (GRCm39) missense probably damaging 1.00
R7414:Map3k19 UTSW 1 127,766,189 (GRCm39) missense probably damaging 0.99
R7686:Map3k19 UTSW 1 127,749,985 (GRCm39) nonsense probably null
R7702:Map3k19 UTSW 1 127,756,827 (GRCm39) missense probably damaging 1.00
R7849:Map3k19 UTSW 1 127,751,383 (GRCm39) missense probably benign 0.21
R8129:Map3k19 UTSW 1 127,750,420 (GRCm39) missense possibly damaging 0.90
R8134:Map3k19 UTSW 1 127,751,492 (GRCm39) missense probably damaging 0.99
R8136:Map3k19 UTSW 1 127,751,492 (GRCm39) missense probably damaging 0.99
R8264:Map3k19 UTSW 1 127,751,528 (GRCm39) missense
R8305:Map3k19 UTSW 1 127,745,007 (GRCm39) missense
R8511:Map3k19 UTSW 1 127,775,155 (GRCm39) missense possibly damaging 0.71
R8808:Map3k19 UTSW 1 127,751,866 (GRCm39) missense probably damaging 1.00
R8913:Map3k19 UTSW 1 127,750,363 (GRCm39) missense probably benign 0.08
R9025:Map3k19 UTSW 1 127,758,175 (GRCm39) missense probably benign 0.06
R9593:Map3k19 UTSW 1 127,778,163 (GRCm39) missense probably benign 0.01
R9681:Map3k19 UTSW 1 127,750,097 (GRCm39) missense possibly damaging 0.61
Z1177:Map3k19 UTSW 1 127,749,771 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AAATAGTAGGTTGACCAGACATTTC -3'
(R):5'- GAATGACGTCATTAAGGATGAGTTG -3'

Sequencing Primer
(F):5'- TATCATGCCGATGCTGGGAAC -3'
(R):5'- GTGGTGCATGTACATGCA -3'
Posted On 2015-02-05