Mutagenetix > Incidental Mutation

Incidental Mutation 'R3025:Tars2'

265792

Institutional Source

Beutler Lab

Gene Symbol

Tars2

Ensembl Gene

ENSMUSG00000028107

Gene Name

threonyl-tRNA synthetase 2, mitochondrial (putative)

Synonyms

Tarsl1, 2610024N01Rik

MMRRC Submission

040541-MU

Accession Numbers

Genbank: NM_027931.3, NM_001163617.1, NM_001163618.1, NM_001163619.1; Ensembl: ENSMUST00000029752, ENSMUST00000074339 , ENSMUST00000098857, ENSMUST00000163530

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R3025 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95739976-95760206 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 95747640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 63 (R63H)

Ref Sequence

ENSEMBL: ENSMUSP00000143757 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029752] [ENSMUST00000074339] [ENSMUST00000098857] [ENSMUST00000163530] [ENSMUST00000195929] [ENSMUST00000196077] [ENSMUST00000196868] [ENSMUST00000197720] [ENSMUST00000198289] [ENSMUST00000199464] [ENSMUST00000199570]

AlphaFold

Q3UQ84

Predicted Effect

probably benign
Transcript: ENSMUST00000029752
AA Change: R351H

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000029752
Gene: ENSMUSG00000028107
AA Change: R351H

Domain	Start	End	E-Value	Type
Pfam:TGS	66	126	5.6e-14	PFAM
tRNA_SAD	233	282	1.15e-10	SMART
Pfam:tRNA-synt_2b	400	608	2.4e-32	PFAM
Pfam:HGTP_anticodon	620	711	1.5e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000074339
AA Change: R351H

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000073946
Gene: ENSMUSG00000028107
AA Change: R351H

Domain	Start	End	E-Value	Type
Pfam:TGS	66	126	1.3e-15	PFAM
tRNA_SAD	233	282	1.15e-10	SMART
Pfam:tRNA-synt_2b	336	519	2.8e-39	PFAM
Pfam:HGTP_anticodon	594	685	5.4e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098857

SMART Domains

Protein: ENSMUSP00000096456
Gene: ENSMUSG00000028107

Domain	Start	End	E-Value	Type
Pfam:TGS	66	126	6.7e-16	PFAM
tRNA_SAD	233	282	1.15e-10	SMART
SCOP:d1atia2	332	417	2e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163530
AA Change: R270H

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000130269
Gene: ENSMUSG00000028107
AA Change: R270H

Domain	Start	End	E-Value	Type
Pfam:TGS	66	126	2.6e-15	PFAM
tRNA_SAD	152	201	1.15e-10	SMART
Pfam:tRNA-synt_2b	255	438	8.6e-40	PFAM
Pfam:HGTP_anticodon	539	630	1.6e-20	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195929
AA Change: R63H

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000143757
Gene: ENSMUSG00000028107
AA Change: R63H

Domain	Start	End	E-Value	Type
Pfam:tRNA_SAD	1	28	3.2e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196077

SMART Domains

Protein: ENSMUSP00000143722
Gene: ENSMUSG00000028107

Domain	Start	End	E-Value	Type
Pfam:TGS	65	125	5e-13	PFAM
tRNA_SAD	232	264	7.5e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196475

Predicted Effect

probably benign
Transcript: ENSMUST00000196868

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197389

Predicted Effect

probably benign
Transcript: ENSMUST00000197720

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197895

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198007

Predicted Effect

probably benign
Transcript: ENSMUST00000198289
AA Change: R112H

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000143271
Gene: ENSMUSG00000028107
AA Change: R112H

Domain	Start	End	E-Value	Type
tRNA_SAD	2	43	2.6e-8	SMART
Pfam:tRNA-synt_2b	97	142	6.4e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199869

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198194

Predicted Effect

probably benign
Transcript: ENSMUST00000199464

SMART Domains

Protein: ENSMUSP00000143328
Gene: ENSMUSG00000028107

Domain	Start	End	E-Value	Type
Pfam:TGS	66	126	1.1e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199570

SMART Domains

Protein: ENSMUSP00000143038
Gene: ENSMUSG00000028107

Domain	Start	End	E-Value	Type
Pfam:TGS	66	126	1.5e-13	PFAM
tRNA_SAD	152	201	8.5e-15	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-II aminoacyl-tRNA synthetase family. The encoded protein is a mitochondrial aminoacyl-tRNA synthetase. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 4. [provided by RefSeq, Dec 2012]

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	T	A	11: 105,974,093		probably null	Het
Akap6	A	G	12: 53,140,143	T1447A	probably benign	Het
Atp13a2	C	T	4: 140,994,348	R250C	probably damaging	Het
Cacna1a	T	A	8: 84,580,225		probably null	Het
Chd6	GATCAT	GAT	2: 160,966,552		probably benign	Het
Cptp	T	C	4: 155,867,221	E5G	possibly damaging	Het
Dnajc16	C	A	4: 141,774,611	V303F	probably benign	Het
Gm10842	T	C	11: 105,147,076	S62P	unknown	Het
Gm17509	T	C	13: 117,220,576		probably benign	Het
Homer1	C	T	13: 93,402,074	Q142*	probably null	Het
Kcnb2	C	A	1: 15,710,835	Q644K	possibly damaging	Het
Map3k19	T	C	1: 127,838,553		probably null	Het
Msh4	T	A	3: 153,863,491	H621L	probably damaging	Het
Ogfod1	A	T	8: 94,063,052	E460D	probably damaging	Het
Olfr228	A	T	2: 86,483,739	M1K	probably null	Het
Olfr808	T	A	10: 129,767,673	F59Y	probably damaging	Het
Rp1	G	A	1: 4,352,675	R61W	probably damaging	Het
Scaf4	A	T	16: 90,251,938	H329Q	unknown	Het
Sec61a1	A	T	6: 88,512,220	D166E	probably damaging	Het
Vmn1r57	A	T	7: 5,220,715	K80*	probably null	Het
Vmn2r106	A	G	17: 20,278,885	W255R	probably benign	Het
Wdr49	C	G	3: 75,333,356	C402S	possibly damaging	Het

Other mutations in Tars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01604:Tars2	APN	3	95740278	missense	probably damaging	1.00
IGL02523:Tars2	APN	3	95741393	missense	probably damaging	1.00
IGL02709:Tars2	APN	3	95742071	splice site	probably benign
IGL03286:Tars2	APN	3	95754755	splice site	probably benign
IGL03348:Tars2	APN	3	95740268	splice site	probably null
B6584:Tars2	UTSW	3	95742150	splice site	probably null
R0548:Tars2	UTSW	3	95742659	missense	probably damaging	1.00
R0657:Tars2	UTSW	3	95748557	missense	probably benign	0.00
R1955:Tars2	UTSW	3	95747454	missense	probably damaging	1.00
R2070:Tars2	UTSW	3	95747638	missense	probably damaging	1.00
R2071:Tars2	UTSW	3	95747638	missense	probably damaging	1.00
R3962:Tars2	UTSW	3	95754756	critical splice donor site	probably null
R4676:Tars2	UTSW	3	95753091	missense	probably damaging	1.00
R4775:Tars2	UTSW	3	95746647	missense	probably damaging	1.00
R5208:Tars2	UTSW	3	95747593	missense	probably damaging	1.00
R5512:Tars2	UTSW	3	95750416	missense	probably damaging	1.00
R5894:Tars2	UTSW	3	95747652	splice site	probably null
R5965:Tars2	UTSW	3	95748152	splice site	probably null
R6381:Tars2	UTSW	3	95754487	nonsense	probably null
R6953:Tars2	UTSW	3	95753114	missense	possibly damaging	0.63
R7042:Tars2	UTSW	3	95750745	missense	probably benign	0.00
R7648:Tars2	UTSW	3	95750982	missense	probably benign	0.26
R7877:Tars2	UTSW	3	95746089	missense	probably damaging	0.99
R7946:Tars2	UTSW	3	95750381	missense	probably damaging	0.99
R8021:Tars2	UTSW	3	95747514	missense	probably benign
R8260:Tars2	UTSW	3	95754820	missense	probably damaging	0.99
R8310:Tars2	UTSW	3	95750959	missense	probably benign	0.02
R8681:Tars2	UTSW	3	95750887	nonsense	probably null
R8697:Tars2	UTSW	3	95746062	missense	possibly damaging	0.75
R8756:Tars2	UTSW	3	95741360	missense	probably benign	0.32
R9498:Tars2	UTSW	3	95740241	missense	probably damaging	1.00
R9653:Tars2	UTSW	3	95748067	missense	probably damaging	1.00
R9746:Tars2	UTSW	3	95754765	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- CAGGGCAGTTCATGGGCTTTAG -3'
(R):5'- GAGCAGAGTCTTGTAGAGGC -3'

Sequencing Primer
(F):5'- AGAGCAAGTGTGTCTTTGGGAC -3'
(R):5'- GGTGACTTAACCAGGTGCTC -3'

Posted On

2015-02-05