Incidental Mutation 'R3025:Atp13a2'
ID 265794
Institutional Source Beutler Lab
Gene Symbol Atp13a2
Ensembl Gene ENSMUSG00000036622
Gene Name ATPase type 13A2
Synonyms
MMRRC Submission 040541-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3025 (G1)
Quality Score 180
Status Not validated
Chromosome 4
Chromosomal Location 140986873-141007330 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 140994348 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 250 (R250C)
Ref Sequence ENSEMBL: ENSMUSP00000126461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037055] [ENSMUST00000127833] [ENSMUST00000168047]
AlphaFold Q9CTG6
Predicted Effect probably damaging
Transcript: ENSMUST00000037055
AA Change: R167C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039648
Gene: ENSMUSG00000036622
AA Change: R167C

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 171 8.9e-27 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 497 3.6e-39 PFAM
Pfam:Hydrolase 502 785 2e-14 PFAM
Pfam:HAD 505 876 3.6e-27 PFAM
transmembrane domain 920 942 N/A INTRINSIC
transmembrane domain 957 979 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
transmembrane domain 1033 1055 N/A INTRINSIC
transmembrane domain 1068 1090 N/A INTRINSIC
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125797
Predicted Effect probably damaging
Transcript: ENSMUST00000127833
AA Change: R167C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132183
Gene: ENSMUSG00000036622
AA Change: R167C

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 164 7.4e-29 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 496 6e-34 PFAM
Pfam:HAD 505 876 4e-27 PFAM
Pfam:Hydrolase 663 879 2.5e-15 PFAM
transmembrane domain 925 947 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
low complexity region 1102 1115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156995
Predicted Effect probably damaging
Transcript: ENSMUST00000168047
AA Change: R250C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126461
Gene: ENSMUSG00000036622
AA Change: R250C

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 156 1e-27 PFAM
Cation_ATPase_N 262 334 9.78e-1 SMART
Pfam:E1-E2_ATPase 339 579 4.8e-34 PFAM
Pfam:HAD 588 959 3e-27 PFAM
Pfam:Hydrolase 726 962 1.8e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P5 subfamily of ATPases which transports inorganic cations as well as other substrates. Mutations in this gene are associated with Kufor-Rakeb syndrome (KRS), also referred to as Parkinson disease 9. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuronal ceroid lipofuscinosis, synuclein accumulation and age-dependent sensorimotor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,974,093 probably null Het
Akap6 A G 12: 53,140,143 T1447A probably benign Het
Cacna1a T A 8: 84,580,225 probably null Het
Chd6 GATCAT GAT 2: 160,966,552 probably benign Het
Cptp T C 4: 155,867,221 E5G possibly damaging Het
Dnajc16 C A 4: 141,774,611 V303F probably benign Het
Gm10842 T C 11: 105,147,076 S62P unknown Het
Gm17509 T C 13: 117,220,576 probably benign Het
Homer1 C T 13: 93,402,074 Q142* probably null Het
Kcnb2 C A 1: 15,710,835 Q644K possibly damaging Het
Map3k19 T C 1: 127,838,553 probably null Het
Msh4 T A 3: 153,863,491 H621L probably damaging Het
Ogfod1 A T 8: 94,063,052 E460D probably damaging Het
Olfr228 A T 2: 86,483,739 M1K probably null Het
Olfr808 T A 10: 129,767,673 F59Y probably damaging Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Scaf4 A T 16: 90,251,938 H329Q unknown Het
Sec61a1 A T 6: 88,512,220 D166E probably damaging Het
Tars2 C T 3: 95,747,640 R63H possibly damaging Het
Vmn1r57 A T 7: 5,220,715 K80* probably null Het
Vmn2r106 A G 17: 20,278,885 W255R probably benign Het
Wdr49 C G 3: 75,333,356 C402S possibly damaging Het
Other mutations in Atp13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Atp13a2 APN 4 140992198 missense probably benign 0.02
IGL01476:Atp13a2 APN 4 141000770 missense probably damaging 1.00
IGL01980:Atp13a2 APN 4 141006152 missense probably benign 0.00
IGL02257:Atp13a2 APN 4 141006089 missense probably benign 0.00
IGL02589:Atp13a2 APN 4 141006411 missense probably damaging 1.00
IGL02936:Atp13a2 APN 4 141001949 missense probably benign 0.00
IGL03032:Atp13a2 APN 4 141000355 missense possibly damaging 0.95
IGL03040:Atp13a2 APN 4 141006173 missense probably damaging 1.00
IGL03271:Atp13a2 APN 4 141000397 missense possibly damaging 0.69
calla UTSW 4 140994332 nonsense probably null
eastern_moon UTSW 4 141005016 missense probably damaging 0.99
yucca_brevifolia UTSW 4 140993802 missense probably damaging 1.00
IGL03054:Atp13a2 UTSW 4 141006968 missense possibly damaging 0.83
PIT4469001:Atp13a2 UTSW 4 140994127 missense unknown
R0634:Atp13a2 UTSW 4 141006929 unclassified probably benign
R0881:Atp13a2 UTSW 4 141003931 missense probably damaging 1.00
R1295:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1296:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1472:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1780:Atp13a2 UTSW 4 141002460 missense possibly damaging 0.73
R1837:Atp13a2 UTSW 4 140994332 nonsense probably null
R1838:Atp13a2 UTSW 4 140994332 nonsense probably null
R1856:Atp13a2 UTSW 4 141004012 missense probably benign 0.43
R1918:Atp13a2 UTSW 4 140996371 missense possibly damaging 0.90
R1956:Atp13a2 UTSW 4 141004261 missense possibly damaging 0.92
R2126:Atp13a2 UTSW 4 140995391 missense possibly damaging 0.94
R2130:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2132:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2133:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2397:Atp13a2 UTSW 4 141003155 missense probably benign 0.00
R2873:Atp13a2 UTSW 4 141002983 missense probably benign 0.00
R3939:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R3940:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R3942:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R4247:Atp13a2 UTSW 4 140992228 critical splice donor site probably null
R4357:Atp13a2 UTSW 4 141001904 missense probably benign 0.01
R4406:Atp13a2 UTSW 4 141006476 missense probably damaging 1.00
R4686:Atp13a2 UTSW 4 141003276 critical splice donor site probably null
R5033:Atp13a2 UTSW 4 141000821 missense possibly damaging 0.91
R5066:Atp13a2 UTSW 4 141005138 missense probably damaging 1.00
R5278:Atp13a2 UTSW 4 141000818 missense probably damaging 0.97
R5464:Atp13a2 UTSW 4 141006070 missense probably damaging 1.00
R5522:Atp13a2 UTSW 4 141004360 splice site probably null
R5614:Atp13a2 UTSW 4 140992182 missense probably benign 0.35
R5846:Atp13a2 UTSW 4 140995596 missense possibly damaging 0.81
R6378:Atp13a2 UTSW 4 141007056 missense probably benign 0.34
R6512:Atp13a2 UTSW 4 141003218 missense probably damaging 1.00
R6518:Atp13a2 UTSW 4 141000854 missense possibly damaging 0.89
R6519:Atp13a2 UTSW 4 141000854 missense possibly damaging 0.89
R7166:Atp13a2 UTSW 4 141006984 missense possibly damaging 0.89
R7178:Atp13a2 UTSW 4 140999151 missense probably damaging 1.00
R7657:Atp13a2 UTSW 4 140992504 missense possibly damaging 0.92
R8256:Atp13a2 UTSW 4 140995611 missense possibly damaging 0.94
R8313:Atp13a2 UTSW 4 141002735 missense probably benign
R8318:Atp13a2 UTSW 4 141007024 missense probably benign 0.14
R8781:Atp13a2 UTSW 4 140996380 missense probably benign 0.36
R9142:Atp13a2 UTSW 4 141002053 missense probably damaging 1.00
R9145:Atp13a2 UTSW 4 140996745 missense probably damaging 0.99
R9158:Atp13a2 UTSW 4 140996801 critical splice donor site probably null
R9256:Atp13a2 UTSW 4 141002727 missense probably damaging 0.98
R9339:Atp13a2 UTSW 4 141003260 missense probably benign 0.00
Z1176:Atp13a2 UTSW 4 141005117 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGAAGGCCTGTGATACTATCTG -3'
(R):5'- ACCCTATGAGGTGAGACGTACC -3'

Sequencing Primer
(F):5'- CTGTGATACTATCTGACCGGCAAG -3'
(R):5'- TGAGACGTACCCTCACCC -3'
Posted On 2015-02-05