Incidental Mutation 'R3025:Dnajc16'
ID 265795
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 2900037O03Rik, 4732437J24Rik
MMRRC Submission 040541-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.724) question?
Stock # R3025 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 141487500-141518242 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 141501922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 303 (V303F)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000038014
AA Change: V303F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: V303F

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138654
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,864,919 (GRCm39) probably null Het
Akap6 A G 12: 53,186,926 (GRCm39) T1447A probably benign Het
Atp13a2 C T 4: 140,721,659 (GRCm39) R250C probably damaging Het
Cacna1a T A 8: 85,306,854 (GRCm39) probably null Het
Chd6 GATCAT GAT 2: 160,808,472 (GRCm39) probably benign Het
Cptp T C 4: 155,951,678 (GRCm39) E5G possibly damaging Het
Gm10842 T C 11: 105,037,902 (GRCm39) S62P unknown Het
Gm17509 T C 13: 117,357,112 (GRCm39) probably benign Het
Homer1 C T 13: 93,538,582 (GRCm39) Q142* probably null Het
Kcnb2 C A 1: 15,781,059 (GRCm39) Q644K possibly damaging Het
Map3k19 T C 1: 127,766,290 (GRCm39) probably null Het
Msh4 T A 3: 153,569,128 (GRCm39) H621L probably damaging Het
Ogfod1 A T 8: 94,789,680 (GRCm39) E460D probably damaging Het
Or6c65 T A 10: 129,603,542 (GRCm39) F59Y probably damaging Het
Or8k41 A T 2: 86,314,083 (GRCm39) M1K probably null Het
Rp1 G A 1: 4,422,898 (GRCm39) R61W probably damaging Het
Scaf4 A T 16: 90,048,826 (GRCm39) H329Q unknown Het
Sec61a1 A T 6: 88,489,202 (GRCm39) D166E probably damaging Het
Tars2 C T 3: 95,654,952 (GRCm39) R63H possibly damaging Het
Vmn1r57 A T 7: 5,223,714 (GRCm39) K80* probably null Het
Vmn2r106 A G 17: 20,499,147 (GRCm39) W255R probably benign Het
Wdr49 C G 3: 75,240,663 (GRCm39) C402S possibly damaging Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141,490,874 (GRCm39) splice site probably null
IGL00840:Dnajc16 APN 4 141,495,314 (GRCm39) missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141,491,008 (GRCm39) missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141,501,940 (GRCm39) missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141,504,244 (GRCm39) missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141,491,958 (GRCm39) missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141,495,043 (GRCm39) nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141,498,260 (GRCm39) missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141,491,996 (GRCm39) missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141,495,318 (GRCm39) missense probably benign
R0415:Dnajc16 UTSW 4 141,516,359 (GRCm39) nonsense probably null
R0532:Dnajc16 UTSW 4 141,516,320 (GRCm39) missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141,495,052 (GRCm39) nonsense probably null
R2959:Dnajc16 UTSW 4 141,493,856 (GRCm39) nonsense probably null
R3796:Dnajc16 UTSW 4 141,495,048 (GRCm39) missense probably benign
R3854:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R3856:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R4661:Dnajc16 UTSW 4 141,490,859 (GRCm39) missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141,495,280 (GRCm39) nonsense probably null
R5126:Dnajc16 UTSW 4 141,501,820 (GRCm39) missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141,491,994 (GRCm39) missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141,502,703 (GRCm39) missense probably benign
R6888:Dnajc16 UTSW 4 141,504,303 (GRCm39) missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141,494,001 (GRCm39) missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141,491,124 (GRCm39) missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141,501,879 (GRCm39) missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141,492,002 (GRCm39) missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141,494,018 (GRCm39) nonsense probably null
R9005:Dnajc16 UTSW 4 141,491,945 (GRCm39) missense possibly damaging 0.95
R9053:Dnajc16 UTSW 4 141,510,371 (GRCm39) missense probably benign 0.28
R9550:Dnajc16 UTSW 4 141,495,058 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTTGAACGCCTGACCCTTG -3'
(R):5'- AAATGAGTCATTCTCCCTTGTCCAG -3'

Sequencing Primer
(F):5'- GACCCTTGCAGTGCATATTTATG -3'
(R):5'- TCCAGTTTTTGTGCATAGGATATC -3'
Posted On 2015-02-05