Mutagenetix > Incidental Mutation

Incidental Mutation 'R3025:Dnajc16'

265795

Institutional Source

Beutler Lab

Gene Symbol

Dnajc16

Ensembl Gene

ENSMUSG00000040697

Gene Name

DnaJ heat shock protein family (Hsp40) member C16

Synonyms

4732437J24Rik, 2900037O03Rik

MMRRC Submission

040541-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.738) question?

Stock #

R3025 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141760189-141790931 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 141774611 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 303 (V303F)

Ref Sequence

ENSEMBL: ENSMUSP00000048714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038014]

AlphaFold

Q80TN4

PDB Structure

Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000038014
AA Change: V303F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: V303F

Domain	Start	End	E-Value	Type
DnaJ	28	85	4.5e-30	SMART
Pfam:Thioredoxin	142	243	4.4e-8	PFAM
low complexity region	537	549	N/A	INTRINSIC
low complexity region	730	750	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138654

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	T	A	11: 105,974,093		probably null	Het
Akap6	A	G	12: 53,140,143	T1447A	probably benign	Het
Atp13a2	C	T	4: 140,994,348	R250C	probably damaging	Het
Cacna1a	T	A	8: 84,580,225		probably null	Het
Chd6	GATCAT	GAT	2: 160,966,552		probably benign	Het
Cptp	T	C	4: 155,867,221	E5G	possibly damaging	Het
Gm10842	T	C	11: 105,147,076	S62P	unknown	Het
Gm17509	T	C	13: 117,220,576		probably benign	Het
Homer1	C	T	13: 93,402,074	Q142*	probably null	Het
Kcnb2	C	A	1: 15,710,835	Q644K	possibly damaging	Het
Map3k19	T	C	1: 127,838,553		probably null	Het
Msh4	T	A	3: 153,863,491	H621L	probably damaging	Het
Ogfod1	A	T	8: 94,063,052	E460D	probably damaging	Het
Olfr228	A	T	2: 86,483,739	M1K	probably null	Het
Olfr808	T	A	10: 129,767,673	F59Y	probably damaging	Het
Rp1	G	A	1: 4,352,675	R61W	probably damaging	Het
Scaf4	A	T	16: 90,251,938	H329Q	unknown	Het
Sec61a1	A	T	6: 88,512,220	D166E	probably damaging	Het
Tars2	C	T	3: 95,747,640	R63H	possibly damaging	Het
Vmn1r57	A	T	7: 5,220,715	K80*	probably null	Het
Vmn2r106	A	G	17: 20,278,885	W255R	probably benign	Het
Wdr49	C	G	3: 75,333,356	C402S	possibly damaging	Het

Other mutations in Dnajc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Dnajc16	APN	4	141763563	splice site	probably null
IGL00840:Dnajc16	APN	4	141768003	missense	probably damaging	1.00
IGL01503:Dnajc16	APN	4	141763697	missense	possibly damaging	0.65
IGL01919:Dnajc16	APN	4	141774629	missense	probably benign	0.06
IGL02065:Dnajc16	APN	4	141776933	missense	probably damaging	1.00
IGL02544:Dnajc16	APN	4	141764647	missense	probably damaging	1.00
IGL03028:Dnajc16	APN	4	141767732	nonsense	probably null
PIT4418001:Dnajc16	UTSW	4	141770949	missense	probably damaging	0.99
PIT4585001:Dnajc16	UTSW	4	141764685	missense	probably damaging	1.00
R0071:Dnajc16	UTSW	4	141768007	missense	probably benign
R0415:Dnajc16	UTSW	4	141789048	nonsense	probably null
R0532:Dnajc16	UTSW	4	141789009	missense	probably damaging	1.00
R1418:Dnajc16	UTSW	4	141767741	nonsense	probably null
R2959:Dnajc16	UTSW	4	141766545	nonsense	probably null
R3796:Dnajc16	UTSW	4	141767737	missense	probably benign
R3854:Dnajc16	UTSW	4	141763653	nonsense	probably null
R3856:Dnajc16	UTSW	4	141763653	nonsense	probably null
R4661:Dnajc16	UTSW	4	141763548	missense	probably damaging	1.00
R4841:Dnajc16	UTSW	4	141774625	missense	probably damaging	1.00
R4842:Dnajc16	UTSW	4	141774625	missense	probably damaging	1.00
R5116:Dnajc16	UTSW	4	141767969	nonsense	probably null
R5126:Dnajc16	UTSW	4	141774509	missense	probably benign	0.01
R5140:Dnajc16	UTSW	4	141764683	missense	possibly damaging	0.85
R5275:Dnajc16	UTSW	4	141767928	missense	possibly damaging	0.82
R5295:Dnajc16	UTSW	4	141767928	missense	possibly damaging	0.82
R5891:Dnajc16	UTSW	4	141775392	missense	probably benign
R6888:Dnajc16	UTSW	4	141776992	missense	probably benign	0.24
R7062:Dnajc16	UTSW	4	141766690	missense	probably damaging	1.00
R7441:Dnajc16	UTSW	4	141763813	missense	probably damaging	1.00
R7684:Dnajc16	UTSW	4	141774568	missense	probably benign	0.02
R8843:Dnajc16	UTSW	4	141764691	missense	possibly damaging	0.87
R8924:Dnajc16	UTSW	4	141766707	nonsense	probably null
R9005:Dnajc16	UTSW	4	141764634	missense	possibly damaging	0.95
R9053:Dnajc16	UTSW	4	141783060	missense	probably benign	0.28
R9550:Dnajc16	UTSW	4	141767747	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TCTTGAACGCCTGACCCTTG -3'
(R):5'- AAATGAGTCATTCTCCCTTGTCCAG -3'

Sequencing Primer
(F):5'- GACCCTTGCAGTGCATATTTATG -3'
(R):5'- TCCAGTTTTTGTGCATAGGATATC -3'

Posted On

2015-02-05