Incidental Mutation 'R3025:Cptp'
ID265796
Institutional Source Beutler Lab
Gene Symbol Cptp
Ensembl Gene ENSMUSG00000029073
Gene Nameceramide-1-phosphate transfer protein
SynonymsGltpd1
MMRRC Submission 040541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R3025 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155864723-155869440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155867221 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 5 (E5G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030901] [ENSMUST00000030949] [ENSMUST00000030950] [ENSMUST00000120794] [ENSMUST00000151961] [ENSMUST00000156460]
Predicted Effect probably benign
Transcript: ENSMUST00000030901
SMART Domains Protein: ENSMUSP00000030901
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
Lactamase_B 16 233 3.38e-17 SMART
Beta-Casp 245 363 6.94e-37 SMART
Pfam:RMMBL 376 418 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030949
SMART Domains Protein: ENSMUSP00000030949
Gene: ENSMUSG00000029072

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 72 469 2e-79 PFAM
Pfam:NCD3G 500 552 1.9e-16 PFAM
Pfam:7tm_3 576 821 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030950
AA Change: E5G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000030950
Gene: ENSMUSG00000029073
AA Change: E5G

DomainStartEndE-ValueType
Pfam:GLTP 27 179 1.4e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105586
AA Change: E5G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101211
Gene: ENSMUSG00000029073
AA Change: E5G

DomainStartEndE-ValueType
PDB:4KBR|H 1 35 3e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000120794
SMART Domains Protein: ENSMUSP00000112656
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
Lactamase_B 16 211 6.42e-9 SMART
Beta-Casp 223 341 6.94e-37 SMART
Pfam:RMMBL 354 396 3.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149458
Predicted Effect probably benign
Transcript: ENSMUST00000151961
AA Change: E5G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115935
Gene: ENSMUSG00000029073
AA Change: E5G

DomainStartEndE-ValueType
Pfam:GLTP 25 181 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156266
Predicted Effect probably benign
Transcript: ENSMUST00000156460
SMART Domains Protein: ENSMUSP00000118803
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
SCOP:d1smla_ 1 66 7e-7 SMART
PDB:2I7V|A 3 38 1e-9 PDB
Blast:Lactamase_B 16 66 4e-30 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T A 11: 105,974,093 probably null Het
Akap6 A G 12: 53,140,143 T1447A probably benign Het
Atp13a2 C T 4: 140,994,348 R250C probably damaging Het
Cacna1a T A 8: 84,580,225 probably null Het
Chd6 GATCAT GAT 2: 160,966,552 probably benign Het
Dnajc16 C A 4: 141,774,611 V303F probably benign Het
Gm10842 T C 11: 105,147,076 S62P unknown Het
Gm17509 T C 13: 117,220,576 probably benign Het
Homer1 C T 13: 93,402,074 Q142* probably null Het
Kcnb2 C A 1: 15,710,835 Q644K possibly damaging Het
Map3k19 T C 1: 127,838,553 probably null Het
Msh4 T A 3: 153,863,491 H621L probably damaging Het
Ogfod1 A T 8: 94,063,052 E460D probably damaging Het
Olfr228 A T 2: 86,483,739 M1K probably null Het
Olfr808 T A 10: 129,767,673 F59Y probably damaging Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Scaf4 A T 16: 90,251,938 H329Q unknown Het
Sec61a1 A T 6: 88,512,220 D166E probably damaging Het
Tars2 C T 3: 95,747,640 R63H possibly damaging Het
Vmn1r57 A T 7: 5,220,715 K80* probably null Het
Vmn2r106 A G 17: 20,278,885 W255R probably benign Het
Wdr49 C G 3: 75,333,356 C402S possibly damaging Het
Other mutations in Cptp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1921:Cptp UTSW 4 155866538 missense probably damaging 1.00
R2279:Cptp UTSW 4 155866421 missense probably damaging 0.98
R4154:Cptp UTSW 4 155867200 missense possibly damaging 0.46
R6194:Cptp UTSW 4 155866641 missense probably damaging 1.00
R7455:Cptp UTSW 4 155866500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGCCAGATAGTCTGCTAGC -3'
(R):5'- TGAAGGGATAGAACTTCACCGTG -3'

Sequencing Primer
(F):5'- AGATAGTCTGCTAGCTGCTCC -3'
(R):5'- GAACTTCACCGTGATTCTCAGGAG -3'
Posted On2015-02-05