Mutagenetix > Incidental Mutation

Incidental Mutation 'R3025:Cacna1a'

265799

Institutional Source

Beutler Lab

Gene Symbol

Cacna1a

Ensembl Gene

ENSMUSG00000034656

Gene Name

calcium channel, voltage-dependent, P/Q type, alpha 1A subunit

Synonyms

Cacnl1a4, alpha1A, SCA6, nmf352, Ccha1a

MMRRC Submission

040541-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.945) question?

Stock #

R3025 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84388440-84640246 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 84580225 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000121390] [ENSMUST00000122053] [ENSMUST00000122053]

AlphaFold

P97445

Predicted Effect

probably null
Transcript: ENSMUST00000121390

SMART Domains

Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	99	373	1.5e-69	PFAM
Pfam:Ion_trans	488	727	1.2e-54	PFAM
Pfam:PKD_channel	578	721	6.6e-8	PFAM
low complexity region	920	959	N/A	INTRINSIC
low complexity region	977	987	N/A	INTRINSIC
low complexity region	1074	1093	N/A	INTRINSIC
low complexity region	1143	1168	N/A	INTRINSIC
Pfam:Ion_trans	1194	1472	4.9e-64	PFAM
Pfam:Ion_trans	1516	1773	2.8e-64	PFAM
Pfam:GPHH	1775	1844	5.6e-39	PFAM
Ca_chan_IQ	1899	1933	1.8e-12	SMART
AT_hook	2053	2065	2.02e0	SMART
low complexity region	2101	2113	N/A	INTRINSIC
low complexity region	2153	2179	N/A	INTRINSIC
low complexity region	2213	2236	N/A	INTRINSIC
low complexity region	2253	2282	N/A	INTRINSIC
low complexity region	2314	2325	N/A	INTRINSIC
low complexity region	2342	2357	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000121390

SMART Domains

Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	99	373	1.5e-69	PFAM
Pfam:Ion_trans	488	727	1.2e-54	PFAM
Pfam:PKD_channel	578	721	6.6e-8	PFAM
low complexity region	920	959	N/A	INTRINSIC
low complexity region	977	987	N/A	INTRINSIC
low complexity region	1074	1093	N/A	INTRINSIC
low complexity region	1143	1168	N/A	INTRINSIC
Pfam:Ion_trans	1194	1472	4.9e-64	PFAM
Pfam:Ion_trans	1516	1773	2.8e-64	PFAM
Pfam:GPHH	1775	1844	5.6e-39	PFAM
Ca_chan_IQ	1899	1933	1.8e-12	SMART
AT_hook	2053	2065	2.02e0	SMART
low complexity region	2101	2113	N/A	INTRINSIC
low complexity region	2153	2179	N/A	INTRINSIC
low complexity region	2213	2236	N/A	INTRINSIC
low complexity region	2253	2282	N/A	INTRINSIC
low complexity region	2314	2325	N/A	INTRINSIC
low complexity region	2342	2357	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000122053

SMART Domains

Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	91	314	4.5e-58	PFAM
PDB:4DEX\|B	317	427	5e-45	PDB
Pfam:Ion_trans	476	668	6.4e-46	PFAM
Pfam:PKD_channel	530	675	7.7e-8	PFAM
low complexity region	873	912	N/A	INTRINSIC
low complexity region	930	940	N/A	INTRINSIC
low complexity region	1027	1046	N/A	INTRINSIC
low complexity region	1096	1121	N/A	INTRINSIC
Pfam:Ion_trans	1183	1414	2.8e-54	PFAM
Pfam:Ion_trans	1504	1714	3.2e-60	PFAM
Ca_chan_IQ	1852	1886	1.8e-12	SMART
AT_hook	2006	2018	2.02e0	SMART
low complexity region	2054	2066	N/A	INTRINSIC
low complexity region	2106	2132	N/A	INTRINSIC
low complexity region	2166	2189	N/A	INTRINSIC
low complexity region	2206	2235	N/A	INTRINSIC
low complexity region	2267	2278	N/A	INTRINSIC
low complexity region	2295	2310	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000122053

SMART Domains

Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	91	314	4.5e-58	PFAM
PDB:4DEX\|B	317	427	5e-45	PDB
Pfam:Ion_trans	476	668	6.4e-46	PFAM
Pfam:PKD_channel	530	675	7.7e-8	PFAM
low complexity region	873	912	N/A	INTRINSIC
low complexity region	930	940	N/A	INTRINSIC
low complexity region	1027	1046	N/A	INTRINSIC
low complexity region	1096	1121	N/A	INTRINSIC
Pfam:Ion_trans	1183	1414	2.8e-54	PFAM
Pfam:Ion_trans	1504	1714	3.2e-60	PFAM
Ca_chan_IQ	1852	1886	1.8e-12	SMART
AT_hook	2006	2018	2.02e0	SMART
low complexity region	2054	2066	N/A	INTRINSIC
low complexity region	2106	2132	N/A	INTRINSIC
low complexity region	2166	2189	N/A	INTRINSIC
low complexity region	2206	2235	N/A	INTRINSIC
low complexity region	2267	2278	N/A	INTRINSIC
low complexity region	2295	2310	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126302

Predicted Effect

probably null
Transcript: ENSMUST00000215756

Predicted Effect

probably null
Transcript: ENSMUST00000215756

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	T	A	11: 105,974,093		probably null	Het
Akap6	A	G	12: 53,140,143	T1447A	probably benign	Het
Atp13a2	C	T	4: 140,994,348	R250C	probably damaging	Het
Chd6	GATCAT	GAT	2: 160,966,552		probably benign	Het
Cptp	T	C	4: 155,867,221	E5G	possibly damaging	Het
Dnajc16	C	A	4: 141,774,611	V303F	probably benign	Het
Gm10842	T	C	11: 105,147,076	S62P	unknown	Het
Gm17509	T	C	13: 117,220,576		probably benign	Het
Homer1	C	T	13: 93,402,074	Q142*	probably null	Het
Kcnb2	C	A	1: 15,710,835	Q644K	possibly damaging	Het
Map3k19	T	C	1: 127,838,553		probably null	Het
Msh4	T	A	3: 153,863,491	H621L	probably damaging	Het
Ogfod1	A	T	8: 94,063,052	E460D	probably damaging	Het
Olfr228	A	T	2: 86,483,739	M1K	probably null	Het
Olfr808	T	A	10: 129,767,673	F59Y	probably damaging	Het
Rp1	G	A	1: 4,352,675	R61W	probably damaging	Het
Scaf4	A	T	16: 90,251,938	H329Q	unknown	Het
Sec61a1	A	T	6: 88,512,220	D166E	probably damaging	Het
Tars2	C	T	3: 95,747,640	R63H	possibly damaging	Het
Vmn1r57	A	T	7: 5,220,715	K80*	probably null	Het
Vmn2r106	A	G	17: 20,278,885	W255R	probably benign	Het
Wdr49	C	G	3: 75,333,356	C402S	possibly damaging	Het

Other mutations in Cacna1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Cacna1a	APN	8	84571208	nonsense	probably null
IGL00513:Cacna1a	APN	8	84553056	missense	probably damaging	1.00
IGL00569:Cacna1a	APN	8	84462714	missense	probably damaging	1.00
IGL00981:Cacna1a	APN	8	84548553	missense	probably damaging	1.00
IGL01122:Cacna1a	APN	8	84614793	critical splice donor site	probably null
IGL01309:Cacna1a	APN	8	84523028	missense	probably damaging	1.00
IGL01380:Cacna1a	APN	8	84559117	missense	probably damaging	1.00
IGL01638:Cacna1a	APN	8	84571827	missense	probably damaging	0.98
IGL01682:Cacna1a	APN	8	84536438	missense	possibly damaging	0.71
IGL02751:Cacna1a	APN	8	84569952	missense	probably damaging	1.00
IGL02904:Cacna1a	APN	8	84579520	missense	probably damaging	1.00
IGL03122:Cacna1a	APN	8	84462676	splice site	probably benign
totter	UTSW	8	84588753	missense	probably damaging	0.99
totter2	UTSW	8	84588753	missense	probably damaging	0.99
FR4340:Cacna1a	UTSW	8	84638723	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638714	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638720	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638723	small insertion	probably benign
FR4548:Cacna1a	UTSW	8	84638717	small insertion	probably benign
FR4737:Cacna1a	UTSW	8	84638720	small insertion	probably benign
FR4737:Cacna1a	UTSW	8	84638726	small insertion	probably benign
FR4976:Cacna1a	UTSW	8	84638717	small insertion	probably benign
FR4976:Cacna1a	UTSW	8	84638726	small insertion	probably benign
IGL03134:Cacna1a	UTSW	8	84559087	missense	probably damaging	1.00
R0055:Cacna1a	UTSW	8	84580058	splice site	probably benign
R0118:Cacna1a	UTSW	8	84536083	missense	probably damaging	1.00
R0284:Cacna1a	UTSW	8	84612285	missense	probably damaging	1.00
R0581:Cacna1a	UTSW	8	84601936	missense	possibly damaging	0.83
R0607:Cacna1a	UTSW	8	84629831	missense	probably damaging	1.00
R1168:Cacna1a	UTSW	8	84579501	missense	probably damaging	1.00
R1183:Cacna1a	UTSW	8	84580217	missense	probably damaging	1.00
R1470:Cacna1a	UTSW	8	84514950	splice site	probably benign
R1503:Cacna1a	UTSW	8	84601946	missense	probably benign	0.23
R1522:Cacna1a	UTSW	8	84633433	missense	probably benign	0.00
R1835:Cacna1a	UTSW	8	84581357	splice site	probably null
R1862:Cacna1a	UTSW	8	84415930	missense	possibly damaging	0.80
R2148:Cacna1a	UTSW	8	84629675	missense	possibly damaging	0.71
R2237:Cacna1a	UTSW	8	84633765	critical splice donor site	probably null
R2567:Cacna1a	UTSW	8	84549725	missense	probably damaging	1.00
R2999:Cacna1a	UTSW	8	84567742	missense	probably damaging	1.00
R3610:Cacna1a	UTSW	8	84559065	missense	probably damaging	1.00
R3702:Cacna1a	UTSW	8	84617846	missense	probably damaging	0.98
R3763:Cacna1a	UTSW	8	84583642	missense	possibly damaging	0.85
R4025:Cacna1a	UTSW	8	84581333	missense	probably damaging	1.00
R4026:Cacna1a	UTSW	8	84581333	missense	probably damaging	1.00
R4106:Cacna1a	UTSW	8	84583695	missense	possibly damaging	0.85
R4296:Cacna1a	UTSW	8	84559293	missense	probably damaging	1.00
R4664:Cacna1a	UTSW	8	84601767	nonsense	probably null
R4713:Cacna1a	UTSW	8	84549514	missense	probably damaging	1.00
R5223:Cacna1a	UTSW	8	84587195	missense	possibly damaging	0.94
R5408:Cacna1a	UTSW	8	84549707	missense	probably damaging	1.00
R5644:Cacna1a	UTSW	8	84462777	missense	probably damaging	1.00
R5734:Cacna1a	UTSW	8	84583731	missense	probably damaging	0.96
R5786:Cacna1a	UTSW	8	84415721	unclassified	probably benign
R5833:Cacna1a	UTSW	8	84518697	missense	probably damaging	1.00
R5886:Cacna1a	UTSW	8	84523022	missense	probably damaging	0.99
R6049:Cacna1a	UTSW	8	84638846	missense	probably damaging	0.96
R6054:Cacna1a	UTSW	8	84556785	missense	probably damaging	0.99
R6117:Cacna1a	UTSW	8	84614721	missense	probably damaging	1.00
R6149:Cacna1a	UTSW	8	84569952	missense	probably damaging	1.00
R6195:Cacna1a	UTSW	8	84588753	missense	probably damaging	0.99
R6233:Cacna1a	UTSW	8	84588753	missense	probably damaging	0.99
R6607:Cacna1a	UTSW	8	84579492	missense	probably damaging	1.00
R6753:Cacna1a	UTSW	8	84580205	missense	probably damaging	1.00
R6798:Cacna1a	UTSW	8	84611602	missense	probably damaging	1.00
R6831:Cacna1a	UTSW	8	84571231	missense	probably damaging	1.00
R6980:Cacna1a	UTSW	8	84612285	missense	possibly damaging	0.85
R7051:Cacna1a	UTSW	8	84629915	missense	possibly damaging	0.85
R7270:Cacna1a	UTSW	8	84571237	missense	probably damaging	1.00
R7409:Cacna1a	UTSW	8	84533402	missense	probably damaging	1.00
R7491:Cacna1a	UTSW	8	84559293	missense	possibly damaging	0.92
R7511:Cacna1a	UTSW	8	84567682	missense	possibly damaging	0.75
R7745:Cacna1a	UTSW	8	84559394	missense	probably benign	0.01
R7872:Cacna1a	UTSW	8	84583654	missense	probably damaging	1.00
R7899:Cacna1a	UTSW	8	84594173	missense	possibly damaging	0.72
R7986:Cacna1a	UTSW	8	84638779	missense	probably benign	0.02
R8126:Cacna1a	UTSW	8	84633252	missense	probably benign	0.02
R8266:Cacna1a	UTSW	8	84559219	missense	probably damaging	1.00
R8458:Cacna1a	UTSW	8	84549458	missense	probably damaging	1.00
R8504:Cacna1a	UTSW	8	84638741	missense	probably benign
R8530:Cacna1a	UTSW	8	84612414	critical splice donor site	probably null
R8750:Cacna1a	UTSW	8	84559155	missense	probably damaging	0.99
R8817:Cacna1a	UTSW	8	84638797	missense	probably benign	0.44
R8856:Cacna1a	UTSW	8	84559441	missense	probably benign	0.30
R8893:Cacna1a	UTSW	8	84587135	missense	probably benign	0.00
R9083:Cacna1a	UTSW	8	84617882	missense	probably benign	0.30
R9087:Cacna1a	UTSW	8	84638803	missense	probably benign	0.44
R9118:Cacna1a	UTSW	8	84536086	missense	probably damaging	1.00
R9133:Cacna1a	UTSW	8	84549523	missense	probably damaging	1.00
R9175:Cacna1a	UTSW	8	84570015	missense	probably damaging	0.99
R9233:Cacna1a	UTSW	8	84544654	missense	probably damaging	1.00
R9310:Cacna1a	UTSW	8	84536417	missense	probably damaging	1.00
R9331:Cacna1a	UTSW	8	84415817	missense	probably damaging	1.00
R9334:Cacna1a	UTSW	8	84569965	missense	probably damaging	1.00
R9531:Cacna1a	UTSW	8	84594172	missense	probably benign	0.02
R9532:Cacna1a	UTSW	8	84611617	missense	probably damaging	1.00
R9590:Cacna1a	UTSW	8	84601981	nonsense	probably null
R9710:Cacna1a	UTSW	8	84594179	missense	possibly damaging	0.74
RF029:Cacna1a	UTSW	8	84638724	small insertion	probably benign
X0022:Cacna1a	UTSW	8	84633699	missense	possibly damaging	0.53
Z1176:Cacna1a	UTSW	8	84415676	missense	unknown
Z1177:Cacna1a	UTSW	8	84579491	missense	probably damaging	1.00
Z1188:Cacna1a	UTSW	8	84515054	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGTTTTCAGCTCACCCAAC -3'
(R):5'- TACTGTTTTCCATGCCGGGG -3'

Sequencing Primer
(F):5'- TTTCAGCTCACCCAACCCCAC -3'
(R):5'- GTGTGTGACAAGTGCTCACTCC -3'

Posted On

2015-02-05