Mutagenetix > Incidental Mutation

Incidental Mutation 'R3025:Ogfod1'

265800

Institutional Source

Beutler Lab

Gene Symbol

Ogfod1

Ensembl Gene

ENSMUSG00000033009

Gene Name

2-oxoglutarate and iron-dependent oxygenase domain containing 1

Synonyms

4930415J21Rik

MMRRC Submission

040541-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3025 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94037198-94067921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 94063052 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 460 (E460D)

Ref Sequence

ENSEMBL: ENSMUSP00000105183 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034206] [ENSMUST00000060632] [ENSMUST00000093301] [ENSMUST00000109556]

AlphaFold

Q3U0K8

Predicted Effect

probably benign
Transcript: ENSMUST00000034206

SMART Domains

Protein: ENSMUSP00000034206
Gene: ENSMUSG00000031755

Domain	Start	End	E-Value	Type
Pfam:BBS2_N	20	161	1.4e-62	PFAM
Pfam:BBS2_Mid	162	272	6.9e-50	PFAM
Pfam:BBS2_C	276	715	2.6e-193	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000060632
AA Change: E445D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051430
Gene: ENSMUSG00000033009
AA Change: E445D

Domain	Start	End	E-Value	Type
P4Hc	46	223	4.87e-26	SMART
Pfam:Ofd1_CTDD	246	513	1.4e-50	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000093301
AA Change: E417D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090991
Gene: ENSMUSG00000033009
AA Change: E417D

Domain	Start	End	E-Value	Type
P4Hc	61	228	2.6e-12	SMART
low complexity region	328	353	N/A	INTRINSIC
low complexity region	375	389	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109556
AA Change: E460D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105183
Gene: ENSMUSG00000033009
AA Change: E460D

Domain	Start	End	E-Value	Type
P4Hc	61	238	4.87e-26	SMART
Pfam:Ofd1_CTDD	261	528	7.2e-51	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele are viable and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	T	A	11: 105,974,093		probably null	Het
Akap6	A	G	12: 53,140,143	T1447A	probably benign	Het
Atp13a2	C	T	4: 140,994,348	R250C	probably damaging	Het
Cacna1a	T	A	8: 84,580,225		probably null	Het
Chd6	GATCAT	GAT	2: 160,966,552		probably benign	Het
Cptp	T	C	4: 155,867,221	E5G	possibly damaging	Het
Dnajc16	C	A	4: 141,774,611	V303F	probably benign	Het
Gm10842	T	C	11: 105,147,076	S62P	unknown	Het
Gm17509	T	C	13: 117,220,576		probably benign	Het
Homer1	C	T	13: 93,402,074	Q142*	probably null	Het
Kcnb2	C	A	1: 15,710,835	Q644K	possibly damaging	Het
Map3k19	T	C	1: 127,838,553		probably null	Het
Msh4	T	A	3: 153,863,491	H621L	probably damaging	Het
Olfr228	A	T	2: 86,483,739	M1K	probably null	Het
Olfr808	T	A	10: 129,767,673	F59Y	probably damaging	Het
Rp1	G	A	1: 4,352,675	R61W	probably damaging	Het
Scaf4	A	T	16: 90,251,938	H329Q	unknown	Het
Sec61a1	A	T	6: 88,512,220	D166E	probably damaging	Het
Tars2	C	T	3: 95,747,640	R63H	possibly damaging	Het
Vmn1r57	A	T	7: 5,220,715	K80*	probably null	Het
Vmn2r106	A	G	17: 20,278,885	W255R	probably benign	Het
Wdr49	C	G	3: 75,333,356	C402S	possibly damaging	Het

Other mutations in Ogfod1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01074:Ogfod1	APN	8	94063006	missense	probably damaging	1.00
IGL01296:Ogfod1	APN	8	94055671	splice site	probably benign
IGL01369:Ogfod1	APN	8	94063091	critical splice donor site	probably null
IGL02113:Ogfod1	APN	8	94064213	missense	probably damaging	1.00
IGL02228:Ogfod1	APN	8	94062987	missense	probably benign	0.00
IGL03057:Ogfod1	APN	8	94056138	missense	possibly damaging	0.78
IGL03071:Ogfod1	APN	8	94057767	missense	probably damaging	1.00
R0391:Ogfod1	UTSW	8	94063023	missense	probably damaging	1.00
R0395:Ogfod1	UTSW	8	94063528	critical splice donor site	probably null
R0518:Ogfod1	UTSW	8	94055248	splice site	probably null
R0605:Ogfod1	UTSW	8	94047267	splice site	probably benign
R0708:Ogfod1	UTSW	8	94039045	missense	possibly damaging	0.89
R0763:Ogfod1	UTSW	8	94055636	missense	probably benign	0.03
R1101:Ogfod1	UTSW	8	94064304	missense	probably benign
R1244:Ogfod1	UTSW	8	94037371	missense	probably benign
R1332:Ogfod1	UTSW	8	94058099	missense	probably damaging	1.00
R1336:Ogfod1	UTSW	8	94058099	missense	probably damaging	1.00
R2301:Ogfod1	UTSW	8	94037368	missense	probably damaging	0.99
R3710:Ogfod1	UTSW	8	94057752	nonsense	probably null
R4612:Ogfod1	UTSW	8	94037347	missense	possibly damaging	0.66
R5349:Ogfod1	UTSW	8	94055248	splice site	probably benign
R5495:Ogfod1	UTSW	8	94064278	missense	probably benign	0.30
R5690:Ogfod1	UTSW	8	94058141	missense	probably damaging	0.99
R6355:Ogfod1	UTSW	8	94062982	missense	probably benign
R7282:Ogfod1	UTSW	8	94037439	missense	possibly damaging	0.47
R7396:Ogfod1	UTSW	8	94038987	missense	probably benign	0.00
R7651:Ogfod1	UTSW	8	94037353	missense	probably benign	0.04
R8868:Ogfod1	UTSW	8	94047278	missense	probably damaging	1.00
X0027:Ogfod1	UTSW	8	94037404	missense	probably benign	0.08
Z1177:Ogfod1	UTSW	8	94037309	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGCCTGACACAAGACCTTATG -3'
(R):5'- AGGAATTAACCTTTCCATACCCAG -3'

Sequencing Primer
(F):5'- ACCTTATGGTGGGTCCTTGTATTC -3'
(R):5'- CCCAGATATAAATTCTGTTTGGGG -3'

Posted On

2015-02-05