Incidental Mutation 'R3025:Ace'
ID 265804
Institutional Source Beutler Lab
Gene Symbol Ace
Ensembl Gene ENSMUSG00000020681
Gene Name angiotensin I converting enzyme (peptidyl-dipeptidase A) 1
Synonyms CD143
MMRRC Submission 040541-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3025 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 105967945-105989964 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 105974093 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000001963] [ENSMUST00000001963] [ENSMUST00000001964]
AlphaFold P09470
Predicted Effect probably null
Transcript: ENSMUST00000001963
SMART Domains Protein: ENSMUSP00000001963
Gene: ENSMUSG00000020681

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Peptidase_M2 45 628 7.1e-257 PFAM
Pfam:Peptidase_M2 648 1226 8.9e-261 PFAM
transmembrane domain 1264 1286 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000001963
SMART Domains Protein: ENSMUSP00000001963
Gene: ENSMUSG00000020681

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Peptidase_M2 45 628 7.1e-257 PFAM
Pfam:Peptidase_M2 648 1226 8.9e-261 PFAM
transmembrane domain 1264 1286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000001964
SMART Domains Protein: ENSMUSP00000001964
Gene: ENSMUSG00000020681

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Peptidase_M2 59 653 N/A PFAM
transmembrane domain 684 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130673
Predicted Effect probably null
Transcript: ENSMUST00000132280
SMART Domains Protein: ENSMUSP00000119826
Gene: ENSMUSG00000020681

DomainStartEndE-ValueType
Pfam:Peptidase_M2 1 395 2.4e-201 PFAM
Pfam:Peptidase_M2 415 993 1.4e-261 PFAM
low complexity region 999 1014 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132280
SMART Domains Protein: ENSMUSP00000119826
Gene: ENSMUSG00000020681

DomainStartEndE-ValueType
Pfam:Peptidase_M2 1 395 2.4e-201 PFAM
Pfam:Peptidase_M2 415 993 1.4e-261 PFAM
low complexity region 999 1014 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132280
SMART Domains Protein: ENSMUSP00000119826
Gene: ENSMUSG00000020681

DomainStartEndE-ValueType
Pfam:Peptidase_M2 1 395 2.4e-201 PFAM
Pfam:Peptidase_M2 415 993 1.4e-261 PFAM
low complexity region 999 1014 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152925
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in catalyzing the conversion of angiotensin I into a physiologically active peptide angiotensin II. Angiotensin II is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This enzyme plays a key role in the renin-angiotensin system. Many studies have associated the presence or absence of a 287 bp Alu repeat element in this gene with the levels of circulating enzyme or cardiovascular pathophysiologies. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, and two most abundant spliced variants encode the somatic form and the testicular form, respectively, that are equally active. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable phenotypes, including reduced systemic blood pressure, normocytic anemia, renal abnormalities, inability to concentrate urine, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 A G 12: 53,140,143 T1447A probably benign Het
Atp13a2 C T 4: 140,994,348 R250C probably damaging Het
Cacna1a T A 8: 84,580,225 probably null Het
Chd6 GATCAT GAT 2: 160,966,552 probably benign Het
Cptp T C 4: 155,867,221 E5G possibly damaging Het
Dnajc16 C A 4: 141,774,611 V303F probably benign Het
Gm10842 T C 11: 105,147,076 S62P unknown Het
Gm17509 T C 13: 117,220,576 probably benign Het
Homer1 C T 13: 93,402,074 Q142* probably null Het
Kcnb2 C A 1: 15,710,835 Q644K possibly damaging Het
Map3k19 T C 1: 127,838,553 probably null Het
Msh4 T A 3: 153,863,491 H621L probably damaging Het
Ogfod1 A T 8: 94,063,052 E460D probably damaging Het
Olfr228 A T 2: 86,483,739 M1K probably null Het
Olfr808 T A 10: 129,767,673 F59Y probably damaging Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Scaf4 A T 16: 90,251,938 H329Q unknown Het
Sec61a1 A T 6: 88,512,220 D166E probably damaging Het
Tars2 C T 3: 95,747,640 R63H possibly damaging Het
Vmn1r57 A T 7: 5,220,715 K80* probably null Het
Vmn2r106 A G 17: 20,278,885 W255R probably benign Het
Wdr49 C G 3: 75,333,356 C402S possibly damaging Het
Other mutations in Ace
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ace APN 11 105979550 missense probably benign 0.21
IGL01105:Ace APN 11 105972059 missense probably damaging 1.00
IGL01761:Ace APN 11 105979493 missense possibly damaging 0.70
IGL01888:Ace APN 11 105968944 missense probably benign
IGL02173:Ace APN 11 105988991 missense probably benign 0.04
IGL02179:Ace APN 11 105969789 missense probably benign 0.16
IGL02331:Ace APN 11 105971344 missense possibly damaging 0.61
IGL02333:Ace APN 11 105971447 missense probably benign
IGL02556:Ace APN 11 105972527 missense probably damaging 1.00
IGL02576:Ace APN 11 105974111 missense probably damaging 1.00
IGL03202:Ace APN 11 105976962 missense probably damaging 1.00
R0403:Ace UTSW 11 105973880 splice site probably null
R0709:Ace UTSW 11 105981538 missense probably damaging 0.97
R1555:Ace UTSW 11 105974901 splice site probably null
R1603:Ace UTSW 11 105972099 missense probably benign 0.23
R1644:Ace UTSW 11 105985106 missense probably damaging 1.00
R1834:Ace UTSW 11 105986094 splice site probably benign
R2074:Ace UTSW 11 105976623 nonsense probably null
R3176:Ace UTSW 11 105976702 missense probably null 1.00
R3276:Ace UTSW 11 105976702 missense probably null 1.00
R3977:Ace UTSW 11 105981838 missense possibly damaging 0.96
R4506:Ace UTSW 11 105976666 missense probably damaging 0.98
R4598:Ace UTSW 11 105981759 splice site probably null
R4914:Ace UTSW 11 105979597 missense probably damaging 1.00
R4968:Ace UTSW 11 105981853 missense possibly damaging 0.93
R5137:Ace UTSW 11 105974826 missense probably damaging 1.00
R5274:Ace UTSW 11 105968037 missense probably benign
R5332:Ace UTSW 11 105973879 critical splice donor site probably null
R5388:Ace UTSW 11 105988458 missense possibly damaging 0.85
R5425:Ace UTSW 11 105973428 missense probably damaging 1.00
R5640:Ace UTSW 11 105970685 missense probably damaging 1.00
R5838:Ace UTSW 11 105972880 missense probably benign 0.00
R6041:Ace UTSW 11 105975308 missense probably benign 0.27
R6083:Ace UTSW 11 105985267 nonsense probably null
R6106:Ace UTSW 11 105989012 missense probably damaging 1.00
R6225:Ace UTSW 11 105979619 missense possibly damaging 0.51
R6607:Ace UTSW 11 105972377 missense possibly damaging 0.82
R6918:Ace UTSW 11 105972943 missense probably damaging 1.00
R7330:Ace UTSW 11 105986061 missense probably damaging 1.00
R7471:Ace UTSW 11 105973482 missense probably damaging 1.00
R7709:Ace UTSW 11 105988837 missense probably benign 0.01
R7800:Ace UTSW 11 105986058 missense probably damaging 1.00
R7855:Ace UTSW 11 105972379 missense probably benign 0.05
R7947:Ace UTSW 11 105973054 missense possibly damaging 0.81
R8063:Ace UTSW 11 105971364 missense possibly damaging 0.90
R8072:Ace UTSW 11 105972959 missense probably damaging 0.98
R8412:Ace UTSW 11 105979266 missense probably benign
R8544:Ace UTSW 11 105971290 critical splice acceptor site probably null
R8695:Ace UTSW 11 105985145 missense probably benign 0.00
R8731:Ace UTSW 11 105970600 missense possibly damaging 0.93
R8855:Ace UTSW 11 105970598 nonsense probably null
R9087:Ace UTSW 11 105981919 missense probably damaging 1.00
R9149:Ace UTSW 11 105972473 missense possibly damaging 0.57
R9347:Ace UTSW 11 105974132 missense probably damaging 1.00
R9590:Ace UTSW 11 105985680 missense probably benign 0.01
X0018:Ace UTSW 11 105971384 missense probably damaging 1.00
X0063:Ace UTSW 11 105975638 missense probably benign 0.07
Z1177:Ace UTSW 11 105988134 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCTCCTTCAGACCCAAG -3'
(R):5'- GACAGCTACCTGCAGAAACG -3'

Sequencing Primer
(F):5'- GGGTTGAGAGTCAGAATGCTCC -3'
(R):5'- GCTACCTGCAGAAACGACCTC -3'
Posted On 2015-02-05