Mutagenetix > Incidental Mutation

Incidental Mutation 'R3025:Homer1'

265807

Institutional Source

Beutler Lab

Gene Symbol

Homer1

Ensembl Gene

ENSMUSG00000007617

Gene Name

homer scaffolding protein 1

Synonyms

PSD-Zip45, Ves-1

MMRRC Submission

040541-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.843) question?

Stock #

R3025 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

93299635-93405129 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 93402074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 142 (Q142*)

Ref Sequence

ENSEMBL: ENSMUSP00000105124 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060490] [ENSMUST00000079086] [ENSMUST00000080127] [ENSMUST00000109495] [ENSMUST00000109496] [ENSMUST00000109497] [ENSMUST00000109498]

AlphaFold

Q9Z2Y3

Predicted Effect

probably null
Transcript: ENSMUST00000060490
AA Change: Q304*

SMART Domains

Protein: ENSMUSP00000050471
Gene: ENSMUSG00000007617
AA Change: Q304*

Domain	Start	End	E-Value	Type
WH1	1	107	4.27e-46	SMART
low complexity region	255	268	N/A	INTRINSIC
PDB:3CVE\|D	290	354	2e-34	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000079086
AA Change: Q320*

SMART Domains

Protein: ENSMUSP00000078093
Gene: ENSMUSG00000007617
AA Change: Q320*

Domain	Start	End	E-Value	Type
WH1	17	123	2.73e-44	SMART
low complexity region	271	284	N/A	INTRINSIC
PDB:3CVE\|D	306	370	3e-34	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000080127
AA Change: Q316*

SMART Domains

Protein: ENSMUSP00000079026
Gene: ENSMUSG00000007617
AA Change: Q316*

Domain	Start	End	E-Value	Type
WH1	1	107	4.27e-46	SMART
low complexity region	267	280	N/A	INTRINSIC
PDB:3CVE\|D	302	366	2e-34	PDB

Predicted Effect

silent
Transcript: ENSMUST00000109495

SMART Domains

Protein: ENSMUSP00000105121
Gene: ENSMUSG00000007617

Domain	Start	End	E-Value	Type
WH1	1	107	4.27e-46	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109496
AA Change: Q174*

SMART Domains

Protein: ENSMUSP00000105122
Gene: ENSMUSG00000007617
AA Change: Q174*

Domain	Start	End	E-Value	Type
WH1	1	107	1.01e-38	SMART
low complexity region	125	138	N/A	INTRINSIC
PDB:3CVE\|D	160	224	2e-35	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000109497
AA Change: Q130*

SMART Domains

Protein: ENSMUSP00000105123
Gene: ENSMUSG00000007617
AA Change: Q130*

Domain	Start	End	E-Value	Type
low complexity region	81	94	N/A	INTRINSIC
PDB:3CVE\|D	116	180	9e-36	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000109498
AA Change: Q142*

SMART Domains

Protein: ENSMUSP00000105124
Gene: ENSMUSG00000007617
AA Change: Q142*

Domain	Start	End	E-Value	Type
low complexity region	93	106	N/A	INTRINSIC
PDB:3CVE\|D	128	192	9e-36	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homer family of dendritic proteins. Members of this family regulate group 1 metabotrophic glutamate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit an increase in spontaneous calcium influx in pancreatic acinar cells. Mice homozygous for a knock-out allele exhibit decreased response to formalin-induced pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	T	A	11: 105,974,093		probably null	Het
Akap6	A	G	12: 53,140,143	T1447A	probably benign	Het
Atp13a2	C	T	4: 140,994,348	R250C	probably damaging	Het
Cacna1a	T	A	8: 84,580,225		probably null	Het
Chd6	GATCAT	GAT	2: 160,966,552		probably benign	Het
Cptp	T	C	4: 155,867,221	E5G	possibly damaging	Het
Dnajc16	C	A	4: 141,774,611	V303F	probably benign	Het
Gm10842	T	C	11: 105,147,076	S62P	unknown	Het
Gm17509	T	C	13: 117,220,576		probably benign	Het
Kcnb2	C	A	1: 15,710,835	Q644K	possibly damaging	Het
Map3k19	T	C	1: 127,838,553		probably null	Het
Msh4	T	A	3: 153,863,491	H621L	probably damaging	Het
Ogfod1	A	T	8: 94,063,052	E460D	probably damaging	Het
Olfr228	A	T	2: 86,483,739	M1K	probably null	Het
Olfr808	T	A	10: 129,767,673	F59Y	probably damaging	Het
Rp1	G	A	1: 4,352,675	R61W	probably damaging	Het
Scaf4	A	T	16: 90,251,938	H329Q	unknown	Het
Sec61a1	A	T	6: 88,512,220	D166E	probably damaging	Het
Tars2	C	T	3: 95,747,640	R63H	possibly damaging	Het
Vmn1r57	A	T	7: 5,220,715	K80*	probably null	Het
Vmn2r106	A	G	17: 20,278,885	W255R	probably benign	Het
Wdr49	C	G	3: 75,333,356	C402S	possibly damaging	Het

Other mutations in Homer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Homer1	APN	13	93387688	splice site	probably benign
IGL00427:Homer1	APN	13	93402114	missense	probably benign	0.05
IGL00479:Homer1	APN	13	93346648	missense	probably damaging	1.00
PIT4151001:Homer1	UTSW	13	93349216	missense	probably damaging	1.00
R0153:Homer1	UTSW	13	93391746	missense	possibly damaging	0.92
R3437:Homer1	UTSW	13	93366421	intron	probably benign
R4418:Homer1	UTSW	13	93402069	missense	probably damaging	1.00
R4666:Homer1	UTSW	13	93402159	missense	probably damaging	0.99
R4718:Homer1	UTSW	13	93391764	missense	probably damaging	1.00
R5413:Homer1	UTSW	13	93391779	missense	probably benign	0.01
R5665:Homer1	UTSW	13	93356102	missense	probably benign	0.03
R5798:Homer1	UTSW	13	93402095	missense	probably damaging	1.00
R6092:Homer1	UTSW	13	93366437	intron	probably benign
R6486:Homer1	UTSW	13	93391725	missense	possibly damaging	0.73
R6617:Homer1	UTSW	13	93341862	missense	probably damaging	1.00
R7101:Homer1	UTSW	13	93356054	missense	probably benign	0.00
R7384:Homer1	UTSW	13	93393039	missense	possibly damaging	0.90
R8362:Homer1	UTSW	13	93366289	missense	unknown
R8772:Homer1	UTSW	13	93391731	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGATGGCTGAATACAAATCTCC -3'
(R):5'- TCTTGGTACGGAGCCCAAAC -3'

Sequencing Primer
(F):5'- GGCTGAATACAAATCTCCTTAAATTG -3'
(R):5'- GACAGACAGCATCTCTCCATCTATTG -3'

Posted On

2015-02-05