Mutagenetix > Incidental Mutation

Incidental Mutation 'R3025:Vmn2r106'

265810

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r106

Ensembl Gene

ENSMUSG00000091656

Gene Name

vomeronasal 2, receptor 106

Synonyms

EG224576

MMRRC Submission

040541-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R3025 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20267547-20285430 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20278885 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 255 (W255R)

Ref Sequence

ENSEMBL: ENSMUSP00000126534 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167464]

AlphaFold

E9PY92

Predicted Effect

probably benign
Transcript: ENSMUST00000167464
AA Change: W255R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000126534
Gene: ENSMUSG00000091656
AA Change: W255R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	471	3.8e-37	PFAM
Pfam:NCD3G	514	567	5.7e-22	PFAM
Pfam:7tm_3	596	835	1.3e-49	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	T	A	11: 105,974,093		probably null	Het
Akap6	A	G	12: 53,140,143	T1447A	probably benign	Het
Atp13a2	C	T	4: 140,994,348	R250C	probably damaging	Het
Cacna1a	T	A	8: 84,580,225		probably null	Het
Chd6	GATCAT	GAT	2: 160,966,552		probably benign	Het
Cptp	T	C	4: 155,867,221	E5G	possibly damaging	Het
Dnajc16	C	A	4: 141,774,611	V303F	probably benign	Het
Gm10842	T	C	11: 105,147,076	S62P	unknown	Het
Gm17509	T	C	13: 117,220,576		probably benign	Het
Homer1	C	T	13: 93,402,074	Q142*	probably null	Het
Kcnb2	C	A	1: 15,710,835	Q644K	possibly damaging	Het
Map3k19	T	C	1: 127,838,553		probably null	Het
Msh4	T	A	3: 153,863,491	H621L	probably damaging	Het
Ogfod1	A	T	8: 94,063,052	E460D	probably damaging	Het
Olfr228	A	T	2: 86,483,739	M1K	probably null	Het
Olfr808	T	A	10: 129,767,673	F59Y	probably damaging	Het
Rp1	G	A	1: 4,352,675	R61W	probably damaging	Het
Scaf4	A	T	16: 90,251,938	H329Q	unknown	Het
Sec61a1	A	T	6: 88,512,220	D166E	probably damaging	Het
Tars2	C	T	3: 95,747,640	R63H	possibly damaging	Het
Vmn1r57	A	T	7: 5,220,715	K80*	probably null	Het
Wdr49	C	G	3: 75,333,356	C402S	possibly damaging	Het

Other mutations in Vmn2r106

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Vmn2r106	APN	17	20277575	missense	possibly damaging	0.90
IGL01313:Vmn2r106	APN	17	20278389	missense	probably damaging	0.99
IGL01419:Vmn2r106	APN	17	20279545	missense	probably benign	0.06
IGL01574:Vmn2r106	APN	17	20268310	missense	possibly damaging	0.94
IGL01796:Vmn2r106	APN	17	20268052	missense	possibly damaging	0.79
IGL01893:Vmn2r106	APN	17	20277468	missense	probably benign	0.06
IGL01895:Vmn2r106	APN	17	20278965	missense	probably benign	0.02
IGL02378:Vmn2r106	APN	17	20277529	missense	probably damaging	1.00
IGL02430:Vmn2r106	APN	17	20278896	missense	probably benign	0.38
IGL02664:Vmn2r106	APN	17	20268082	missense	possibly damaging	0.88
IGL03308:Vmn2r106	APN	17	20278523	nonsense	probably null
IGL03384:Vmn2r106	APN	17	20268143	missense	probably damaging	0.99
R0401:Vmn2r106	UTSW	17	20279019	missense	possibly damaging	0.86
R0842:Vmn2r106	UTSW	17	20268203	missense	probably damaging	1.00
R0964:Vmn2r106	UTSW	17	20267597	missense	probably benign	0.00
R1235:Vmn2r106	UTSW	17	20279479	missense	probably benign	0.00
R1709:Vmn2r106	UTSW	17	20279111	missense	probably benign	0.12
R1712:Vmn2r106	UTSW	17	20278735	missense	probably benign	0.01
R1770:Vmn2r106	UTSW	17	20268298	missense	probably damaging	0.99
R2049:Vmn2r106	UTSW	17	20268304	missense	possibly damaging	0.90
R2245:Vmn2r106	UTSW	17	20268161	missense	probably benign	0.13
R2336:Vmn2r106	UTSW	17	20268208	missense	probably benign	0.18
R2910:Vmn2r106	UTSW	17	20278684	missense	probably damaging	1.00
R3944:Vmn2r106	UTSW	17	20267651	missense	probably damaging	1.00
R4081:Vmn2r106	UTSW	17	20267556	nonsense	probably null
R4153:Vmn2r106	UTSW	17	20267818	missense	probably damaging	1.00
R4356:Vmn2r106	UTSW	17	20279648	missense	probably benign	0.06
R4426:Vmn2r106	UTSW	17	20285379	missense	probably benign	0.00
R4590:Vmn2r106	UTSW	17	20277466	missense	probably damaging	0.99
R4661:Vmn2r106	UTSW	17	20267623	missense	probably benign	0.10
R5106:Vmn2r106	UTSW	17	20279133	critical splice acceptor site	probably null
R5341:Vmn2r106	UTSW	17	20277526	missense	probably benign	0.00
R5509:Vmn2r106	UTSW	17	20278422	missense	probably damaging	0.99
R5826:Vmn2r106	UTSW	17	20278871	missense	probably benign
R5859:Vmn2r106	UTSW	17	20285321	missense	possibly damaging	0.72
R5937:Vmn2r106	UTSW	17	20285405	nonsense	probably null
R5972:Vmn2r106	UTSW	17	20278476	missense	probably benign
R6056:Vmn2r106	UTSW	17	20267544	splice site	probably null
R6108:Vmn2r106	UTSW	17	20268376	missense	probably benign	0.11
R6114:Vmn2r106	UTSW	17	20268376	missense	probably benign	0.11
R6115:Vmn2r106	UTSW	17	20268376	missense	probably benign	0.11
R6132:Vmn2r106	UTSW	17	20268404	missense	probably benign
R6208:Vmn2r106	UTSW	17	20268329	missense	probably damaging	0.99
R6217:Vmn2r106	UTSW	17	20268239	missense	probably benign	0.10
R6289:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6378:Vmn2r106	UTSW	17	20278405	missense	probably benign	0.19
R6390:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6391:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6392:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6405:Vmn2r106	UTSW	17	20279099	missense	probably benign	0.22
R6427:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6428:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6435:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6436:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6437:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6511:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6512:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6587:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6703:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6730:Vmn2r106	UTSW	17	20278834	missense	possibly damaging	0.64
R6961:Vmn2r106	UTSW	17	20268384	nonsense	probably null
R7054:Vmn2r106	UTSW	17	20278920	missense	probably damaging	0.96
R7379:Vmn2r106	UTSW	17	20267775	missense	possibly damaging	0.75
R7402:Vmn2r106	UTSW	17	20267621	missense	probably damaging	0.99
R7497:Vmn2r106	UTSW	17	20267939	missense	probably damaging	1.00
R7692:Vmn2r106	UTSW	17	20285228	missense	possibly damaging	0.96
R8539:Vmn2r106	UTSW	17	20279009	missense	probably benign	0.00
R8827:Vmn2r106	UTSW	17	20267606	missense	probably benign	0.05
R8872:Vmn2r106	UTSW	17	20268139	missense	probably benign	0.19
R9118:Vmn2r106	UTSW	17	20285405	missense	probably benign	0.00
R9254:Vmn2r106	UTSW	17	20275804	missense	probably damaging	1.00
R9379:Vmn2r106	UTSW	17	20275804	missense	probably damaging	1.00
R9571:Vmn2r106	UTSW	17	20285379	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- ATCAGCATAGTCAGTAACATGTGG -3'
(R):5'- TGATCCCATCTTGAGTGACCG -3'

Sequencing Primer
(F):5'- GTGGTTCAATGTTCAAGACCCAGAC -3'
(R):5'- GATCCCATCTTGAGTGACCGAAGTC -3'

Posted On

2015-02-05