Incidental Mutation 'R3026:Gba2'
ID265814
Institutional Source Beutler Lab
Gene Symbol Gba2
Ensembl Gene ENSMUSG00000028467
Gene Nameglucosidase beta 2
Synonymsbile acid
MMRRC Submission 040542-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3026 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43566928-43578873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43578308 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 14 (A14S)
Ref Sequence ENSEMBL: ENSMUSP00000119589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030189] [ENSMUST00000030190] [ENSMUST00000107884] [ENSMUST00000107886] [ENSMUST00000117140] [ENSMUST00000130443]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030189
AA Change: A14S

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467
AA Change: A14S

DomainStartEndE-ValueType
Pfam:GBA2_N 142 446 9.4e-106 PFAM
Pfam:DUF608 512 879 1.3e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030190
SMART Domains Protein: ENSMUSP00000030190
Gene: ENSMUSG00000028468

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
Pfam:Rgp1 66 212 3.4e-34 PFAM
Pfam:Rgp1 182 332 1.2e-41 PFAM
low complexity region 333 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107884
SMART Domains Protein: ENSMUSP00000103516
Gene: ENSMUSG00000078719

DomainStartEndE-ValueType
Pfam:PSP94 36 118 4.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107886
SMART Domains Protein: ENSMUSP00000103518
Gene: ENSMUSG00000028468

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
Pfam:Rgp1 84 164 3.3e-24 PFAM
Pfam:Rgp1 174 331 4.1e-26 PFAM
low complexity region 333 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117140
SMART Domains Protein: ENSMUSP00000113476
Gene: ENSMUSG00000028468

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
Pfam:Rgp1 84 165 2.9e-24 PFAM
Pfam:Rgp1 173 331 3.5e-26 PFAM
low complexity region 333 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128403
Predicted Effect possibly damaging
Transcript: ENSMUST00000130443
AA Change: A14S

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467
AA Change: A14S

DomainStartEndE-ValueType
Pfam:GBA2_N 142 180 5.6e-13 PFAM
Pfam:GBA2_N 178 227 1.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152251
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microsomal beta-glucosidase that catalyzes the hydrolysis of bile acid 3-O-glucosides as endogenous compounds. Studies to determine subcellular localization of this protein in the liver indicated that the enzyme was mainly enriched in the microsomal fraction where it appeared to be confined to the endoplasmic reticulum. This putative transmembrane protein is thought to play a role in carbohydrate transport and metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of glucosylceramides in multiple tissues, and show impaired male fertility associated with globozoospermia, oligozoospermia, reduced sperm motility, and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 A G 4: 59,062,656 S867P possibly damaging Het
BC051665 T A 13: 60,784,707 N55Y probably damaging Het
Cdh19 T C 1: 110,954,688 T25A probably benign Het
Eef1akmt1 A T 14: 57,550,434 S156T probably damaging Het
Fsip1 T C 2: 118,249,903 H124R probably benign Het
Iqgap2 T A 13: 95,673,056 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk8ip2 C T 15: 89,461,446 A803V probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nav3 A G 10: 109,824,604 S702P probably damaging Het
Nudt14 T C 12: 112,941,992 Q27R probably null Het
Olfr555 T C 7: 102,659,129 F103L possibly damaging Het
Pdilt T A 7: 119,514,954 Q107L probably benign Het
Rasgrp3 T C 17: 75,524,921 V579A possibly damaging Het
Rasl11a G A 5: 146,847,377 V211I probably benign Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Spc24 AGAGGTAGTCACTGA AGA 9: 21,756,215 probably null Het
Synj1 A T 16: 90,978,734 D385E probably damaging Het
Usp48 A G 4: 137,594,444 E49G probably benign Het
Vmn1r202 C T 13: 22,501,762 V162I probably benign Het
Other mutations in Gba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Gba2 APN 4 43568477 missense probably damaging 1.00
IGL01577:Gba2 APN 4 43573753 nonsense probably null
IGL02066:Gba2 APN 4 43570175 missense probably benign 0.18
IGL02126:Gba2 APN 4 43567918 critical splice acceptor site probably null
IGL02243:Gba2 APN 4 43568719 missense probably benign 0.13
IGL02474:Gba2 APN 4 43568538 missense possibly damaging 0.69
IGL02567:Gba2 APN 4 43567281 missense probably benign
IGL02628:Gba2 APN 4 43568919 missense probably benign 0.01
IGL02706:Gba2 APN 4 43567257 missense probably benign 0.01
IGL02795:Gba2 APN 4 43578331 missense probably damaging 1.00
R0389:Gba2 UTSW 4 43570832 missense probably damaging 1.00
R0555:Gba2 UTSW 4 43569927 missense probably damaging 1.00
R0650:Gba2 UTSW 4 43570424 unclassified probably null
R1603:Gba2 UTSW 4 43567823 missense probably damaging 1.00
R1628:Gba2 UTSW 4 43570118 missense probably benign 0.00
R1664:Gba2 UTSW 4 43578080 missense probably benign 0.01
R1686:Gba2 UTSW 4 43573869 splice site probably benign
R1730:Gba2 UTSW 4 43578242 missense probably benign 0.01
R2036:Gba2 UTSW 4 43568118 unclassified probably benign
R2061:Gba2 UTSW 4 43574029 nonsense probably null
R2259:Gba2 UTSW 4 43570107 missense probably benign
R2847:Gba2 UTSW 4 43568000 unclassified probably null
R3617:Gba2 UTSW 4 43573803 missense probably damaging 1.00
R4225:Gba2 UTSW 4 43569464 unclassified probably benign
R4346:Gba2 UTSW 4 43571337 missense probably benign 0.04
R4601:Gba2 UTSW 4 43573810 missense probably damaging 1.00
R4611:Gba2 UTSW 4 43568092 missense probably damaging 1.00
R4664:Gba2 UTSW 4 43568619 unclassified probably benign
R4784:Gba2 UTSW 4 43568315 missense probably damaging 1.00
R4785:Gba2 UTSW 4 43568315 missense probably damaging 1.00
R5079:Gba2 UTSW 4 43568640 unclassified probably benign
R5327:Gba2 UTSW 4 43574063 missense probably damaging 1.00
R5746:Gba2 UTSW 4 43568465 unclassified probably null
R6052:Gba2 UTSW 4 43568330 missense probably damaging 1.00
R6485:Gba2 UTSW 4 43574118 missense probably damaging 1.00
R7073:Gba2 UTSW 4 43573753 missense probably damaging 1.00
R7112:Gba2 UTSW 4 43568453 missense probably benign 0.01
R7472:Gba2 UTSW 4 43568967 missense probably benign 0.44
RF007:Gba2 UTSW 4 43569894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCGTGAGCCAAGCAGATC -3'
(R):5'- GGAGCTCTCTGACTTTACCCAG -3'

Sequencing Primer
(F):5'- TCCGCCAGCCAAAAGGAGG -3'
(R):5'- TCTCTGACTTTACCCAGATACCAACG -3'
Posted On2015-02-05