Incidental Mutation 'R3026:Pdilt'
ID265820
Institutional Source Beutler Lab
Gene Symbol Pdilt
Ensembl Gene ENSMUSG00000030968
Gene Nameprotein disulfide isomerase-like, testis expressed
SynonymsPDILT, 1700007B13Rik
MMRRC Submission 040542-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R3026 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119486587-119523489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119514954 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 107 (Q107L)
Ref Sequence ENSEMBL: ENSMUSP00000033267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033267] [ENSMUST00000207796]
Predicted Effect probably benign
Transcript: ENSMUST00000033267
AA Change: Q107L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000033267
Gene: ENSMUSG00000030968
AA Change: Q107L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 86 97 N/A INTRINSIC
Pfam:Thioredoxin_6 177 362 6e-35 PFAM
Pfam:Thioredoxin 385 489 3.7e-16 PFAM
low complexity region 495 512 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182878
Predicted Effect probably benign
Transcript: ENSMUST00000207796
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has has an N-terminal ER-signal sequence, two thioredoxin (TRX) domains with non-classical Ser-Lys-Gln-Ser and Ser-Lys-Lys-Cys motifs, respectively, two TRX-like domains, and a C-terminal ER-retention sequence. The protein lacks oxidoreductase activity in vitro and probably functions as a chaperone. This gene's expression appears to be limited to the testis. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility and abnormal sperm physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 A G 4: 59,062,656 S867P possibly damaging Het
BC051665 T A 13: 60,784,707 N55Y probably damaging Het
Cdh19 T C 1: 110,954,688 T25A probably benign Het
Eef1akmt1 A T 14: 57,550,434 S156T probably damaging Het
Fsip1 T C 2: 118,249,903 H124R probably benign Het
Gba2 C A 4: 43,578,308 A14S possibly damaging Het
Iqgap2 T A 13: 95,673,056 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk8ip2 C T 15: 89,461,446 A803V probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nav3 A G 10: 109,824,604 S702P probably damaging Het
Nudt14 T C 12: 112,941,992 Q27R probably null Het
Olfr555 T C 7: 102,659,129 F103L possibly damaging Het
Rasgrp3 T C 17: 75,524,921 V579A possibly damaging Het
Rasl11a G A 5: 146,847,377 V211I probably benign Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Spc24 AGAGGTAGTCACTGA AGA 9: 21,756,215 probably null Het
Synj1 A T 16: 90,978,734 D385E probably damaging Het
Usp48 A G 4: 137,594,444 E49G probably benign Het
Vmn1r202 C T 13: 22,501,762 V162I probably benign Het
Other mutations in Pdilt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Pdilt APN 7 119500444 missense probably damaging 1.00
IGL02102:Pdilt APN 7 119486950 missense probably benign 0.28
IGL02312:Pdilt APN 7 119519667 missense probably benign 0.03
IGL02887:Pdilt APN 7 119498049 missense possibly damaging 0.86
R0670:Pdilt UTSW 7 119500428 missense probably benign 0.03
R0759:Pdilt UTSW 7 119489484 nonsense probably null
R1525:Pdilt UTSW 7 119487994 missense probably damaging 0.99
R1612:Pdilt UTSW 7 119486975 missense possibly damaging 0.95
R1633:Pdilt UTSW 7 119487994 missense probably damaging 1.00
R1848:Pdilt UTSW 7 119489384 missense probably benign 0.02
R3546:Pdilt UTSW 7 119500488 nonsense probably null
R4406:Pdilt UTSW 7 119495009 missense probably damaging 1.00
R5331:Pdilt UTSW 7 119514924 missense possibly damaging 0.67
R5459:Pdilt UTSW 7 119486935 missense probably benign 0.01
R5771:Pdilt UTSW 7 119494994 missense probably damaging 0.98
R5807:Pdilt UTSW 7 119500543 unclassified probably benign
R6143:Pdilt UTSW 7 119495042 missense probably damaging 1.00
R6456:Pdilt UTSW 7 119500483 missense probably damaging 0.99
R6850:Pdilt UTSW 7 119486959 missense probably damaging 0.98
R7159:Pdilt UTSW 7 119487951 missense probably benign 0.01
R7676:Pdilt UTSW 7 119494997 missense probably damaging 1.00
R8266:Pdilt UTSW 7 119489381 missense probably benign 0.01
R8282:Pdilt UTSW 7 119498070 missense probably damaging 1.00
R8437:Pdilt UTSW 7 119514886 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGGCATGTGGACCAGAGTC -3'
(R):5'- GCTGTGAACACTGGGAAATC -3'

Sequencing Primer
(F):5'- ATGTGGACCAGAGTCTCCCAC -3'
(R):5'- AAATCCAGGGGCTCTCAGGAC -3'
Posted On2015-02-05