Incidental Mutation 'R3026:Eef1akmt1'
ID265828
Institutional Source Beutler Lab
Gene Symbol Eef1akmt1
Ensembl Gene ENSMUSG00000021951
Gene NameEEF1A alpha lysine methyltransferase 1
SynonymsAyu21-96, N6amt2, Gt(Ayu21)96Imeg, GtAyu21-96, 2510005D08Rik
MMRRC Submission 040542-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3026 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location57549597-57571612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57550434 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 156 (S156T)
Ref Sequence ENSEMBL: ENSMUSP00000022518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022518]
Predicted Effect probably damaging
Transcript: ENSMUST00000022518
AA Change: S156T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022518
Gene: ENSMUSG00000021951
AA Change: S156T

DomainStartEndE-ValueType
Pfam:N6-adenineMlase 59 218 7.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225504
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 A G 4: 59,062,656 S867P possibly damaging Het
BC051665 T A 13: 60,784,707 N55Y probably damaging Het
Cdh19 T C 1: 110,954,688 T25A probably benign Het
Fsip1 T C 2: 118,249,903 H124R probably benign Het
Gba2 C A 4: 43,578,308 A14S possibly damaging Het
Iqgap2 T A 13: 95,673,056 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk8ip2 C T 15: 89,461,446 A803V probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nav3 A G 10: 109,824,604 S702P probably damaging Het
Nudt14 T C 12: 112,941,992 Q27R probably null Het
Olfr555 T C 7: 102,659,129 F103L possibly damaging Het
Pdilt T A 7: 119,514,954 Q107L probably benign Het
Rasgrp3 T C 17: 75,524,921 V579A possibly damaging Het
Rasl11a G A 5: 146,847,377 V211I probably benign Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Spc24 AGAGGTAGTCACTGA AGA 9: 21,756,215 probably null Het
Synj1 A T 16: 90,978,734 D385E probably damaging Het
Usp48 A G 4: 137,594,444 E49G probably benign Het
Vmn1r202 C T 13: 22,501,762 V162I probably benign Het
Other mutations in Eef1akmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Eef1akmt1 APN 14 57549790 missense probably damaging 1.00
IGL02011:Eef1akmt1 APN 14 57558098 missense probably damaging 1.00
IGL02839:Eef1akmt1 APN 14 57549781 missense probably damaging 1.00
IGL03090:Eef1akmt1 APN 14 57558086 missense probably damaging 1.00
R1383:Eef1akmt1 UTSW 14 57558032 critical splice donor site probably null
R1447:Eef1akmt1 UTSW 14 57565984 nonsense probably null
R1994:Eef1akmt1 UTSW 14 57550454 missense probably benign 0.02
R4582:Eef1akmt1 UTSW 14 57550448 missense probably damaging 1.00
R4921:Eef1akmt1 UTSW 14 57550632 missense probably damaging 0.97
R5071:Eef1akmt1 UTSW 14 57566007 missense probably damaging 1.00
R5073:Eef1akmt1 UTSW 14 57566007 missense probably damaging 1.00
R6112:Eef1akmt1 UTSW 14 57549873 missense possibly damaging 0.91
R7578:Eef1akmt1 UTSW 14 57549871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACATCACTCAATTCACAATGG -3'
(R):5'- CAAGCGTGTACCAGAAGCTC -3'

Sequencing Primer
(F):5'- CAATTCACAATGGCTCTCTGGGG -3'
(R):5'- TGTACCAGAAGCTCCGGGAG -3'
Posted On2015-02-05