Incidental Mutation 'R3027:Otos'
ID265836
Institutional Source Beutler Lab
Gene Symbol Otos
Ensembl Gene ENSMUSG00000044055
Gene Nameotospiralin
Synonyms
MMRRC Submission 040543-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3027 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92644218-92648841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92644354 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 83 (H83Q)
Ref Sequence ENSEMBL: ENSMUSP00000061683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053144] [ENSMUST00000097642] [ENSMUST00000112999]
Predicted Effect probably damaging
Transcript: ENSMUST00000053144
AA Change: H83Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061683
Gene: ENSMUSG00000044055
AA Change: H83Q

DomainStartEndE-ValueType
Pfam:OTOS 21 89 9.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097642
SMART Domains Protein: ENSMUSP00000095247
Gene: ENSMUSG00000073616

DomainStartEndE-ValueType
Pfam:MYEOV2 1 57 6.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112999
SMART Domains Protein: ENSMUSP00000108623
Gene: ENSMUSG00000073616

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
Pfam:MYEOV2 48 99 2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129730
Predicted Effect probably benign
Transcript: ENSMUST00000148508
SMART Domains Protein: ENSMUSP00000123716
Gene: ENSMUSG00000073616

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159803
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Otospiralin is synthesized by nonsensory cells (fibrocytes) of the inner ear, and downregulation of otospiralin in guinea pigs leads to deafness (Lavigne-Rebillard et al., 2003 [PubMed 12687421]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display decreased endocochlear potentials and shrunken type II and IV cochlear fibrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,329,035 L1193P probably benign Het
Arap2 T C 5: 62,669,897 T993A probably damaging Het
Arhgap18 G A 10: 26,846,096 G21D probably benign Het
Cluap1 T A 16: 3,911,532 C84* probably null Het
Dnmt3a T A 12: 3,849,626 probably null Het
Etaa1 T C 11: 17,947,886 D146G probably damaging Het
Fam227a T C 15: 79,648,733 probably null Het
Htt T A 5: 34,820,095 I775N possibly damaging Het
Itgax C A 7: 128,148,572 Y1053* probably null Het
Kif21a T A 15: 90,972,642 N583Y probably damaging Het
Lrp1b T A 2: 40,870,271 E2995V probably benign Het
Olfr1089 C T 2: 86,733,586 V9M possibly damaging Het
Olfr190 C T 16: 59,074,967 V38I probably benign Het
Olfr303 T C 7: 86,394,553 N315S probably benign Het
Olfr51 G A 11: 51,007,052 V27M possibly damaging Het
Pramel7 A G 2: 87,491,403 M96T probably benign Het
Ptprz1 T A 6: 23,016,197 S1680T possibly damaging Het
Rad50 A G 11: 53,695,381 S263P probably benign Het
Retreg2 A G 1: 75,146,444 S339G probably damaging Het
Schip1 G A 3: 68,494,610 A7T probably damaging Het
Shkbp1 A C 7: 27,343,393 S540A probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Socs1 T C 16: 10,784,714 D53G possibly damaging Het
Spag9 G T 11: 94,086,377 R103L probably null Het
Spc24 AGAGGTAGTCACTGA AGA 9: 21,756,215 probably null Het
Spo11 T C 2: 172,985,943 Y146H probably damaging Het
Tmem25 T C 9: 44,798,214 probably null Het
Ttyh1 A G 7: 4,119,722 D23G probably benign Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp513 A G 5: 31,199,329 S540P possibly damaging Het
Zfp808 A T 13: 62,171,590 H211L probably benign Het
Other mutations in Otos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03293:Otos APN 1 92644413 nonsense probably null
R0766:Otos UTSW 1 92645351 missense probably damaging 1.00
R1868:Otos UTSW 1 92644463 missense probably damaging 1.00
R4922:Otos UTSW 1 92644368 missense probably damaging 0.99
R4954:Otos UTSW 1 92644445 missense probably damaging 0.99
R5100:Otos UTSW 1 92644385 missense probably damaging 1.00
R5152:Otos UTSW 1 92644394 missense probably damaging 1.00
R7388:Otos UTSW 1 92644519 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGCTAATTCACAGTGCGG -3'
(R):5'- ATGAGACAGGCACCGAGACTAC -3'

Sequencing Primer
(F):5'- TTCACAGTGCGGCAGTATAC -3'
(R):5'- GCACCGAGACTACCTGTGTCTTG -3'
Posted On2015-02-05