Incidental Mutation 'R3027:Pramel7'
ID265839
Institutional Source Beutler Lab
Gene Symbol Pramel7
Ensembl Gene ENSMUSG00000025839
Gene Namepreferentially expressed antigen in melanoma like 7
Synonyms
MMRRC Submission 040543-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R3027 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87489087-87497093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87491403 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 96 (M96T)
Ref Sequence ENSEMBL: ENSMUSP00000026957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026957]
Predicted Effect probably benign
Transcript: ENSMUST00000026957
AA Change: M96T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000026957
Gene: ENSMUSG00000025839
AA Change: M96T

DomainStartEndE-ValueType
SCOP:d1a4ya_ 207 407 3e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148030
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,329,035 L1193P probably benign Het
Arap2 T C 5: 62,669,897 T993A probably damaging Het
Arhgap18 G A 10: 26,846,096 G21D probably benign Het
Cluap1 T A 16: 3,911,532 C84* probably null Het
Dnmt3a T A 12: 3,849,626 probably null Het
Etaa1 T C 11: 17,947,886 D146G probably damaging Het
Fam227a T C 15: 79,648,733 probably null Het
Htt T A 5: 34,820,095 I775N possibly damaging Het
Itgax C A 7: 128,148,572 Y1053* probably null Het
Kif21a T A 15: 90,972,642 N583Y probably damaging Het
Lrp1b T A 2: 40,870,271 E2995V probably benign Het
Olfr1089 C T 2: 86,733,586 V9M possibly damaging Het
Olfr190 C T 16: 59,074,967 V38I probably benign Het
Olfr303 T C 7: 86,394,553 N315S probably benign Het
Olfr51 G A 11: 51,007,052 V27M possibly damaging Het
Otos A T 1: 92,644,354 H83Q probably damaging Het
Ptprz1 T A 6: 23,016,197 S1680T possibly damaging Het
Rad50 A G 11: 53,695,381 S263P probably benign Het
Retreg2 A G 1: 75,146,444 S339G probably damaging Het
Schip1 G A 3: 68,494,610 A7T probably damaging Het
Shkbp1 A C 7: 27,343,393 S540A probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Socs1 T C 16: 10,784,714 D53G possibly damaging Het
Spag9 G T 11: 94,086,377 R103L probably null Het
Spc24 AGAGGTAGTCACTGA AGA 9: 21,756,215 probably null Het
Spo11 T C 2: 172,985,943 Y146H probably damaging Het
Tmem25 T C 9: 44,798,214 probably null Het
Ttyh1 A G 7: 4,119,722 D23G probably benign Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp513 A G 5: 31,199,329 S540P possibly damaging Het
Zfp808 A T 13: 62,171,590 H211L probably benign Het
Other mutations in Pramel7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Pramel7 APN 2 87491085 missense probably damaging 1.00
IGL01302:Pramel7 APN 2 87491373 missense possibly damaging 0.58
IGL01365:Pramel7 APN 2 87491413 splice site probably benign
IGL01728:Pramel7 APN 2 87491330 missense possibly damaging 0.95
IGL01769:Pramel7 APN 2 87489588 missense probably benign 0.09
IGL01932:Pramel7 APN 2 87491113 missense possibly damaging 0.80
IGL02971:Pramel7 APN 2 87490073 missense probably benign 0.03
IGL03376:Pramel7 APN 2 87489603 missense probably damaging 1.00
IGL03380:Pramel7 APN 2 87491372 missense probably benign 0.38
R0625:Pramel7 UTSW 2 87491008 missense probably benign 0.02
R1077:Pramel7 UTSW 2 87491190 missense probably damaging 1.00
R1455:Pramel7 UTSW 2 87489723 missense probably benign 0.00
R1666:Pramel7 UTSW 2 87492403 missense probably damaging 0.99
R1863:Pramel7 UTSW 2 87491331 missense probably benign 0.35
R1977:Pramel7 UTSW 2 87491121 missense probably benign 0.01
R2141:Pramel7 UTSW 2 87489977 missense probably damaging 1.00
R4374:Pramel7 UTSW 2 87490071 missense probably benign 0.05
R4735:Pramel7 UTSW 2 87490843 nonsense probably null
R5232:Pramel7 UTSW 2 87489976 missense probably damaging 0.97
R6255:Pramel7 UTSW 2 87489663 missense probably benign 0.00
R6611:Pramel7 UTSW 2 87490049 missense probably damaging 1.00
R6898:Pramel7 UTSW 2 87489726 missense probably damaging 0.98
R7246:Pramel7 UTSW 2 87492165 missense probably damaging 1.00
R7293:Pramel7 UTSW 2 87492362 missense probably benign 0.28
R7408:Pramel7 UTSW 2 87490845 missense possibly damaging 0.89
R7431:Pramel7 UTSW 2 87489938 missense possibly damaging 0.65
R7469:Pramel7 UTSW 2 87491404 missense probably benign 0.01
R8300:Pramel7 UTSW 2 87489623 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCACTCCAATAACAGTGTTTGG -3'
(R):5'- TCTTCAGATGCAGCTCAGGC -3'

Sequencing Primer
(F):5'- CCAATAACAGTGTTTGGTGTTTATCC -3'
(R):5'- TGCAGCTCAGGCAAGGTG -3'
Posted On2015-02-05