Incidental Mutation 'R3027:Etaa1'
ID265857
Institutional Source Beutler Lab
Gene Symbol Etaa1
Ensembl Gene ENSMUSG00000016984
Gene NameEwing tumor-associated antigen 1
Synonyms5730466H23Rik
MMRRC Submission 040543-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3027 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location17938756-17953875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17947886 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 146 (D146G)
Ref Sequence ENSEMBL: ENSMUSP00000075957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076661]
Predicted Effect probably damaging
Transcript: ENSMUST00000076661
AA Change: D146G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075957
Gene: ENSMUSG00000016984
AA Change: D146G

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
Pfam:ETAA1 79 865 N/A PFAM
Meta Mutation Damage Score 0.0682 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,329,035 L1193P probably benign Het
Arap2 T C 5: 62,669,897 T993A probably damaging Het
Arhgap18 G A 10: 26,846,096 G21D probably benign Het
Cluap1 T A 16: 3,911,532 C84* probably null Het
Dnmt3a T A 12: 3,849,626 probably null Het
Fam227a T C 15: 79,648,733 probably null Het
Htt T A 5: 34,820,095 I775N possibly damaging Het
Itgax C A 7: 128,148,572 Y1053* probably null Het
Kif21a T A 15: 90,972,642 N583Y probably damaging Het
Lrp1b T A 2: 40,870,271 E2995V probably benign Het
Olfr1089 C T 2: 86,733,586 V9M possibly damaging Het
Olfr190 C T 16: 59,074,967 V38I probably benign Het
Olfr303 T C 7: 86,394,553 N315S probably benign Het
Olfr51 G A 11: 51,007,052 V27M possibly damaging Het
Otos A T 1: 92,644,354 H83Q probably damaging Het
Pramel7 A G 2: 87,491,403 M96T probably benign Het
Ptprz1 T A 6: 23,016,197 S1680T possibly damaging Het
Rad50 A G 11: 53,695,381 S263P probably benign Het
Retreg2 A G 1: 75,146,444 S339G probably damaging Het
Schip1 G A 3: 68,494,610 A7T probably damaging Het
Shkbp1 A C 7: 27,343,393 S540A probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Socs1 T C 16: 10,784,714 D53G possibly damaging Het
Spag9 G T 11: 94,086,377 R103L probably null Het
Spc24 AGAGGTAGTCACTGA AGA 9: 21,756,215 probably null Het
Spo11 T C 2: 172,985,943 Y146H probably damaging Het
Tmem25 T C 9: 44,798,214 probably null Het
Ttyh1 A G 7: 4,119,722 D23G probably benign Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp513 A G 5: 31,199,329 S540P possibly damaging Het
Zfp808 A T 13: 62,171,590 H211L probably benign Het
Other mutations in Etaa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Etaa1 APN 11 17947825 nonsense probably null
IGL00555:Etaa1 APN 11 17947535 missense probably damaging 1.00
IGL01098:Etaa1 APN 11 17946059 missense probably damaging 0.99
IGL01100:Etaa1 APN 11 17952576 critical splice donor site probably null
IGL01312:Etaa1 APN 11 17945909 missense probably damaging 1.00
IGL01391:Etaa1 APN 11 17946005 missense probably damaging 1.00
IGL01607:Etaa1 APN 11 17953637 missense probably benign 0.00
IGL02066:Etaa1 APN 11 17946687 missense probably benign
R0401:Etaa1 UTSW 11 17947514 missense probably damaging 1.00
R0413:Etaa1 UTSW 11 17946350 nonsense probably null
R0790:Etaa1 UTSW 11 17946051 missense probably benign 0.00
R1442:Etaa1 UTSW 11 17947201 missense probably benign 0.19
R1447:Etaa1 UTSW 11 17946625 missense possibly damaging 0.92
R1647:Etaa1 UTSW 11 17946492 missense probably damaging 0.99
R1945:Etaa1 UTSW 11 17947233 missense probably damaging 0.96
R1996:Etaa1 UTSW 11 17952671 missense probably damaging 1.00
R2211:Etaa1 UTSW 11 17952686 nonsense probably null
R2338:Etaa1 UTSW 11 17945605 critical splice donor site probably null
R3546:Etaa1 UTSW 11 17953823 start gained probably benign
R4118:Etaa1 UTSW 11 17946180 missense probably benign 0.18
R4156:Etaa1 UTSW 11 17940281 missense probably damaging 1.00
R4657:Etaa1 UTSW 11 17946964 missense possibly damaging 0.81
R4882:Etaa1 UTSW 11 17946174 missense probably benign 0.10
R4914:Etaa1 UTSW 11 17946532 missense probably benign 0.05
R4978:Etaa1 UTSW 11 17946581 missense probably damaging 0.99
R5202:Etaa1 UTSW 11 17947853 missense probably damaging 1.00
R5384:Etaa1 UTSW 11 17947539 missense probably damaging 1.00
R5584:Etaa1 UTSW 11 17947406 missense possibly damaging 0.72
R6303:Etaa1 UTSW 11 17947505 missense probably damaging 1.00
R6304:Etaa1 UTSW 11 17947505 missense probably damaging 1.00
R6351:Etaa1 UTSW 11 17947188 missense possibly damaging 0.95
R6391:Etaa1 UTSW 11 17946833 missense probably benign 0.04
R6685:Etaa1 UTSW 11 17953582 missense probably benign 0.40
R6705:Etaa1 UTSW 11 17945639 missense probably benign 0.02
R6807:Etaa1 UTSW 11 17952680 missense probably benign
R6863:Etaa1 UTSW 11 17953794 start codon destroyed probably benign 0.01
R6985:Etaa1 UTSW 11 17946108 missense probably damaging 0.99
R7129:Etaa1 UTSW 11 17940339 missense possibly damaging 0.92
R7429:Etaa1 UTSW 11 17940281 missense probably damaging 1.00
Z1088:Etaa1 UTSW 11 17946465 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CTGTTGGGCCAATTTCATAAGTTC -3'
(R):5'- GGATCATAGCTTCTGACATAATGC -3'

Sequencing Primer
(F):5'- GGGCCAATTTCATAAGTTCTTTTTC -3'
(R):5'- GACATAATGCCTTTCTCCAGC -3'
Posted On2015-02-05