Incidental Mutation 'R3028:Hcrtr1'
ID 265874
Institutional Source Beutler Lab
Gene Symbol Hcrtr1
Ensembl Gene ENSMUSG00000028778
Gene Name hypocretin (orexin) receptor 1
Synonyms OX1R
MMRRC Submission 040544-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R3028 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 130130217-130139359 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 130135811 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 159 (R159L)
Ref Sequence ENSEMBL: ENSMUSP00000127290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030562] [ENSMUST00000119423] [ENSMUST00000120154] [ENSMUST00000164887]
AlphaFold P58307
Predicted Effect probably benign
Transcript: ENSMUST00000030562
AA Change: R159L

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030562
Gene: ENSMUSG00000028778
AA Change: R159L

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119423
AA Change: R159L

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112630
Gene: ENSMUSG00000028778
AA Change: R159L

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 5.3e-56 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120154
AA Change: R159L

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113198
Gene: ENSMUSG00000028778
AA Change: R159L

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164887
AA Change: R159L

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127290
Gene: ENSMUSG00000028778
AA Change: R159L

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein selectively binds the hypothalamic neuropeptide orexin A. A related gene (HCRTR2) encodes a G-protein coupled receptor that binds orexin A and orexin B. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for one null allele display increased susceptibility to pharmacologically induced seizures. Mice homozygous for a second null allele display a decrease in depression like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt2 T G 8: 18,703,544 K289Q probably benign Het
Avl9 T A 6: 56,730,687 probably benign Het
Crybg2 A G 4: 134,073,784 K752E probably benign Het
Cyp4a10 T C 4: 115,518,431 F37S possibly damaging Het
Gtpbp1 C T 15: 79,715,879 T369I possibly damaging Het
Hipk3 T C 2: 104,433,790 I809V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhdc4 C T 8: 121,799,549 V284M probably damaging Het
N6amt1 C G 16: 87,362,648 H147Q probably benign Het
Pdgfra A T 5: 75,174,981 H425L probably damaging Het
Phlpp2 C T 8: 109,907,613 A240V probably damaging Het
Ppib A T 9: 66,066,307 K181* probably null Het
Rab11fip3 A G 17: 26,015,942 probably null Het
Sftpc A T 14: 70,521,425 H161Q probably benign Het
Sigirr A G 7: 141,092,279 L251P probably damaging Het
Skint6 A T 4: 113,236,493 M151K possibly damaging Het
Spc24 AGAGGTAGTCACTGA AGA 9: 21,756,215 probably null Het
Speer3 T A 5: 13,795,431 N159K probably damaging Het
Spire1 A C 18: 67,491,347 S581A probably damaging Het
Susd6 C T 12: 80,874,460 T277I probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Hcrtr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Hcrtr1 APN 4 130137269 missense probably damaging 1.00
IGL00754:Hcrtr1 APN 4 130137233 missense probably damaging 1.00
IGL02005:Hcrtr1 APN 4 130137263 missense probably benign 0.31
R0084:Hcrtr1 UTSW 4 130137266 missense possibly damaging 0.79
R0590:Hcrtr1 UTSW 4 130135694 missense probably damaging 0.96
R1531:Hcrtr1 UTSW 4 130130927 nonsense probably null
R1659:Hcrtr1 UTSW 4 130135336 nonsense probably null
R2055:Hcrtr1 UTSW 4 130130887 missense probably benign 0.08
R4488:Hcrtr1 UTSW 4 130135763 missense probably benign 0.02
R4967:Hcrtr1 UTSW 4 130130999 missense possibly damaging 0.69
R5301:Hcrtr1 UTSW 4 130137670 splice site probably null
R5375:Hcrtr1 UTSW 4 130135725 missense probably benign 0.08
R5636:Hcrtr1 UTSW 4 130130945 missense possibly damaging 0.59
R6283:Hcrtr1 UTSW 4 130135340 missense probably benign 0.01
R6505:Hcrtr1 UTSW 4 130137586 missense probably benign
R7018:Hcrtr1 UTSW 4 130135868 missense probably damaging 1.00
R7042:Hcrtr1 UTSW 4 130130860 unclassified probably benign
R7091:Hcrtr1 UTSW 4 130130914 missense probably damaging 0.99
R7259:Hcrtr1 UTSW 4 130135818 missense possibly damaging 0.79
R7612:Hcrtr1 UTSW 4 130135685 missense possibly damaging 0.61
R8140:Hcrtr1 UTSW 4 130135290 missense probably damaging 0.99
R9410:Hcrtr1 UTSW 4 130135721 missense probably damaging 0.98
Z1177:Hcrtr1 UTSW 4 130133873 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTCCAGAAGTGCCCATTAC -3'
(R):5'- TTTGCCACACAAAGTCTCATTG -3'

Sequencing Primer
(F):5'- GAAGTGCCCATTACCTGCC -3'
(R):5'- GGTGAGTGACTTGCCCAAATTCAC -3'
Posted On 2015-02-05