Incidental Mutation 'R3028:Spire1'
ID265893
Institutional Source Beutler Lab
Gene Symbol Spire1
Ensembl Gene ENSMUSG00000024533
Gene Namespire type actin nucleation factor 1
Synonyms6030430B19Rik, Spir-1
MMRRC Submission 040544-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R3028 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location67488209-67610790 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 67491347 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 581 (S581A)
Ref Sequence ENSEMBL: ENSMUSP00000110702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045105
AA Change: S626A

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533
AA Change: S626A

DomainStartEndE-ValueType
Pfam:KIND 1 78 3.3e-27 PFAM
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 289 316 N/A INTRINSIC
low complexity region 339 350 N/A INTRINSIC
SCOP:d1zbdb_ 445 518 1e-7 SMART
low complexity region 596 606 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082243
AA Change: S581A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533
AA Change: S581A

DomainStartEndE-ValueType
Blast:KIND 1 73 2e-26 BLAST
PDB:3RBW|D 1 79 3e-28 PDB
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 302 329 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
SCOP:d1zbdb_ 400 473 2e-7 SMART
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115050
AA Change: S581A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533
AA Change: S581A

DomainStartEndE-ValueType
PDB:4EFH|B 106 162 9e-6 PDB
low complexity region 219 246 N/A INTRINSIC
low complexity region 269 280 N/A INTRINSIC
SCOP:d1zbdb_ 317 390 4e-7 SMART
low complexity region 468 478 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000224122
AA Change: S326A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224659
Predicted Effect possibly damaging
Transcript: ENSMUST00000224799
AA Change: S498A

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt2 T G 8: 18,703,544 K289Q probably benign Het
Avl9 T A 6: 56,730,687 probably benign Het
Crybg2 A G 4: 134,073,784 K752E probably benign Het
Cyp4a10 T C 4: 115,518,431 F37S possibly damaging Het
Gtpbp1 C T 15: 79,715,879 T369I possibly damaging Het
Hcrtr1 C A 4: 130,135,811 R159L probably benign Het
Hipk3 T C 2: 104,433,790 I809V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhdc4 C T 8: 121,799,549 V284M probably damaging Het
N6amt1 C G 16: 87,362,648 H147Q probably benign Het
Pdgfra A T 5: 75,174,981 H425L probably damaging Het
Phlpp2 C T 8: 109,907,613 A240V probably damaging Het
Ppib A T 9: 66,066,307 K181* probably null Het
Rab11fip3 A G 17: 26,015,942 probably null Het
Sftpc A T 14: 70,521,425 H161Q probably benign Het
Sigirr A G 7: 141,092,279 L251P probably damaging Het
Skint6 A T 4: 113,236,493 M151K possibly damaging Het
Spc24 AGAGGTAGTCACTGA AGA 9: 21,756,215 probably null Het
Speer3 T A 5: 13,795,431 N159K probably damaging Het
Susd6 C T 12: 80,874,460 T277I probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Spire1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Spire1 APN 18 67529015 missense probably damaging 1.00
IGL01639:Spire1 APN 18 67545668 missense possibly damaging 0.74
IGL02334:Spire1 APN 18 67506655 missense probably benign 0.00
PIT4677001:Spire1 UTSW 18 67491365 missense probably damaging 1.00
R0457:Spire1 UTSW 18 67552600 missense probably damaging 0.98
R0531:Spire1 UTSW 18 67491305 missense probably damaging 1.00
R0608:Spire1 UTSW 18 67528875 missense probably damaging 0.99
R2098:Spire1 UTSW 18 67503466 missense probably damaging 0.99
R2299:Spire1 UTSW 18 67530423 missense probably damaging 1.00
R3815:Spire1 UTSW 18 67506663 missense probably benign 0.05
R4049:Spire1 UTSW 18 67529031 splice site probably null
R4050:Spire1 UTSW 18 67529031 splice site probably null
R4059:Spire1 UTSW 18 67545713 missense probably damaging 0.98
R4109:Spire1 UTSW 18 67497217 missense probably damaging 1.00
R4700:Spire1 UTSW 18 67512865 missense probably benign 0.01
R4941:Spire1 UTSW 18 67519314 missense possibly damaging 0.54
R4995:Spire1 UTSW 18 67552779 unclassified probably null
R5363:Spire1 UTSW 18 67506555 missense probably damaging 1.00
R5561:Spire1 UTSW 18 67506646 missense probably damaging 0.96
R5795:Spire1 UTSW 18 67495195 missense probably benign
R5952:Spire1 UTSW 18 67506709 missense probably benign 0.00
R5982:Spire1 UTSW 18 67497316 critical splice acceptor site probably null
R7388:Spire1 UTSW 18 67519880 missense probably damaging 1.00
R7559:Spire1 UTSW 18 67501117 missense probably benign 0.04
T0970:Spire1 UTSW 18 67501063 splice site probably null
Z1088:Spire1 UTSW 18 67495152 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CGGCTGATATGAACACAGCC -3'
(R):5'- TCCAGGTCTGTGGACAAGTC -3'

Sequencing Primer
(F):5'- AACACAGCCTTGAGTCTGTG -3'
(R):5'- TCCGATGAGGAGCTCCAGTTTC -3'
Posted On2015-02-05