Incidental Mutation 'R3029:Rgs20'
ID265894
Institutional Source Beutler Lab
Gene Symbol Rgs20
Ensembl Gene ENSMUSG00000002459
Gene Nameregulator of G-protein signaling 20
SynonymsRgsz1, 2900073E09Rik
MMRRC Submission 040545-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3029 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location4909576-5070285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5070053 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 42 (D42G)
Ref Sequence ENSEMBL: ENSMUSP00000113398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118000] [ENSMUST00000147158] [ENSMUST00000192847]
Predicted Effect probably benign
Transcript: ENSMUST00000118000
AA Change: D42G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113398
Gene: ENSMUSG00000002459
AA Change: D42G

DomainStartEndE-ValueType
low complexity region 123 135 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 192 204 N/A INTRINSIC
RGS 246 362 2.09e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133521
Predicted Effect probably benign
Transcript: ENSMUST00000147158
AA Change: D42G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117380
Gene: ENSMUSG00000002459
AA Change: D42G

DomainStartEndE-ValueType
low complexity region 92 104 N/A INTRINSIC
Pfam:RGS 146 200 2.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192847
SMART Domains Protein: ENSMUSP00000141636
Gene: ENSMUSG00000033793

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 342 1e-102 PFAM
Pfam:V-ATPase_H_C 332 423 2.7e-25 PFAM
Pfam:Arm_2 339 427 4.6e-5 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,718,245 I213T probably benign Het
Atp8a2 CGT CGTGT 14: 59,691,465 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk6 G A 5: 3,390,817 probably null Het
Cryab T A 9: 50,756,338 I124N probably damaging Het
E2f5 A G 3: 14,603,665 I206V probably benign Het
Eya4 T C 10: 23,123,878 T396A probably benign Het
Fat2 T C 11: 55,284,709 Y1726C probably damaging Het
Gad1 G A 2: 70,594,690 V443I probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Itgad T A 7: 128,178,371 I141N possibly damaging Het
Kcnh1 C T 1: 192,506,060 T970M probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp1a T A 11: 71,123,630 T265S probably damaging Het
Nsun4 A G 4: 116,052,725 S213P possibly damaging Het
Pkdrej C T 15: 85,817,004 R1577Q probably benign Het
Proz A T 8: 13,061,042 I5F probably benign Het
Rbm48 A T 5: 3,596,043 F54I possibly damaging Het
Rxfp2 A C 5: 150,043,130 D111A probably benign Het
Sparcl1 T C 5: 104,093,226 T111A possibly damaging Het
Vmn2r14 T A 5: 109,215,910 L713F probably damaging Het
Other mutations in Rgs20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Rgs20 APN 1 5070015 missense probably benign 0.04
IGL01433:Rgs20 APN 1 5070077 missense possibly damaging 0.85
IGL01691:Rgs20 APN 1 4916922 missense probably benign 0.00
R0573:Rgs20 UTSW 1 5020814 missense possibly damaging 0.85
R1274:Rgs20 UTSW 1 4912447 missense probably damaging 1.00
R1305:Rgs20 UTSW 1 5021039 unclassified probably null
R1513:Rgs20 UTSW 1 4912337 missense probably damaging 1.00
R1568:Rgs20 UTSW 1 5020827 missense probably benign 0.00
R1763:Rgs20 UTSW 1 4910640 missense probably damaging 1.00
R1794:Rgs20 UTSW 1 4910572 missense probably damaging 1.00
R2118:Rgs20 UTSW 1 4916890 splice site probably benign
R2437:Rgs20 UTSW 1 5070147 splice site probably null
R4665:Rgs20 UTSW 1 5021008 missense probably benign 0.00
R5014:Rgs20 UTSW 1 4910547 missense probably damaging 1.00
R5433:Rgs20 UTSW 1 5070110 missense possibly damaging 0.93
R5620:Rgs20 UTSW 1 4912443 missense probably damaging 1.00
R5880:Rgs20 UTSW 1 4923881 missense probably damaging 0.99
R5990:Rgs20 UTSW 1 4912330 missense probably benign 0.11
R6188:Rgs20 UTSW 1 5020883 frame shift probably null
R7323:Rgs20 UTSW 1 4912312 critical splice donor site probably null
R7459:Rgs20 UTSW 1 4910634 missense probably benign 0.04
R7467:Rgs20 UTSW 1 4912330 missense probably benign 0.11
R8101:Rgs20 UTSW 1 4912415 missense probably benign 0.16
Z1176:Rgs20 UTSW 1 5070114 missense probably benign
Z1177:Rgs20 UTSW 1 5021019 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGCTGTTTAGAATGGAGAAAACTG -3'
(R):5'- AGAGGATCTACAGGTATTGGTAAAACC -3'

Sequencing Primer
(F):5'- GTTTAGAATGGAGAAAACTGGATTCC -3'
(R):5'- ACCAGATGACACTATTCCTGTGGG -3'
Posted On2015-02-05