Incidental Mutation 'R3029:A630001G21Rik'
ID265896
Institutional Source Beutler Lab
Gene Symbol A630001G21Rik
Ensembl Gene ENSMUSG00000052760
Gene NameRIKEN cDNA A630001G21 gene
Synonyms
MMRRC Submission 040545-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R3029 (G1)
Quality Score201
Status Not validated
Chromosome1
Chromosomal Location85717083-85778643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85718245 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 213 (I213T)
Ref Sequence ENSEMBL: ENSMUSP00000124137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064788] [ENSMUST00000159122] [ENSMUST00000162038]
Predicted Effect probably benign
Transcript: ENSMUST00000064788
AA Change: I213T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000070374
Gene: ENSMUSG00000052760
AA Change: I213T

DomainStartEndE-ValueType
Pfam:Sp100 11 109 3.1e-40 PFAM
low complexity region 168 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159122
AA Change: I213T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124137
Gene: ENSMUSG00000052760
AA Change: I213T

DomainStartEndE-ValueType
Pfam:Sp100 9 112 8.3e-45 PFAM
low complexity region 168 187 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161453
Predicted Effect probably benign
Transcript: ENSMUST00000162038
SMART Domains Protein: ENSMUSP00000125643
Gene: ENSMUSG00000052760

DomainStartEndE-ValueType
Pfam:Sp100 11 109 4e-41 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a2 CGT CGTGT 14: 59,691,465 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk6 G A 5: 3,390,817 probably null Het
Cryab T A 9: 50,756,338 I124N probably damaging Het
E2f5 A G 3: 14,603,665 I206V probably benign Het
Eya4 T C 10: 23,123,878 T396A probably benign Het
Fat2 T C 11: 55,284,709 Y1726C probably damaging Het
Gad1 G A 2: 70,594,690 V443I probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Itgad T A 7: 128,178,371 I141N possibly damaging Het
Kcnh1 C T 1: 192,506,060 T970M probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp1a T A 11: 71,123,630 T265S probably damaging Het
Nsun4 A G 4: 116,052,725 S213P possibly damaging Het
Pkdrej C T 15: 85,817,004 R1577Q probably benign Het
Proz A T 8: 13,061,042 I5F probably benign Het
Rbm48 A T 5: 3,596,043 F54I possibly damaging Het
Rgs20 T C 1: 5,070,053 D42G probably benign Het
Rxfp2 A C 5: 150,043,130 D111A probably benign Het
Sparcl1 T C 5: 104,093,226 T111A possibly damaging Het
Vmn2r14 T A 5: 109,215,910 L713F probably damaging Het
Other mutations in A630001G21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:A630001G21Rik APN 1 85725171 missense probably damaging 0.96
FR4737:A630001G21Rik UTSW 1 85723135 utr 3 prime probably benign
PIT4469001:A630001G21Rik UTSW 1 85725199 missense probably benign 0.00
R0423:A630001G21Rik UTSW 1 85726466 missense probably benign 0.03
R4417:A630001G21Rik UTSW 1 85726463 missense probably damaging 0.98
R4876:A630001G21Rik UTSW 1 85719040 missense probably damaging 0.98
R5592:A630001G21Rik UTSW 1 85726611 missense probably damaging 0.96
R5719:A630001G21Rik UTSW 1 85723385 missense probably benign 0.01
R5780:A630001G21Rik UTSW 1 85718318 missense probably benign 0.02
X0020:A630001G21Rik UTSW 1 85725259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTGTGGGTCAGAGAGAC -3'
(R):5'- CCTGTCATTCACTGAGAGCC -3'

Sequencing Primer
(F):5'- GAAAGTCTTCCTTAGCCATCCAGGG -3'
(R):5'- TGTCATTCACTGAGAGCCCTAAGG -3'
Posted On2015-02-05