Incidental Mutation 'R3029:Gad1'
ID265898
Institutional Source Beutler Lab
Gene Symbol Gad1
Ensembl Gene ENSMUSG00000070880
Gene Nameglutamate decarboxylase 1
SynonymsGAD25, GAD67, Gad-1, Z49976, GAD44, EP10
MMRRC Submission 040545-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3029 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location70553072-70602014 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70594690 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 443 (V443I)
Ref Sequence ENSEMBL: ENSMUSP00000092539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094934]
Predicted Effect probably benign
Transcript: ENSMUST00000094934
AA Change: V443I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092539
Gene: ENSMUSG00000070880
AA Change: V443I

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Pyridoxal_deC 143 517 7e-154 PFAM
Pfam:Beta_elim_lyase 231 375 3.2e-6 PFAM
Pfam:Aminotran_5 273 380 2.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140478
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is an enzyme that catalyzes the production of gamma-aminobutyric acid from L-glutamic acid. Alternative splicing of this gene results in two products, the predominant 67 kDa isoform and a smaller 25 kDa isoform. The smaller isoform is not thought to retain catalytic activity. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations die at birth with cleft palate and apnea and exhibit reduced levels of glutamic acid decarboxylase and gamma-aminobutyric acid in the cerebral cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,718,245 I213T probably benign Het
Atp8a2 CGT CGTGT 14: 59,691,465 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk6 G A 5: 3,390,817 probably null Het
Cryab T A 9: 50,756,338 I124N probably damaging Het
E2f5 A G 3: 14,603,665 I206V probably benign Het
Eya4 T C 10: 23,123,878 T396A probably benign Het
Fat2 T C 11: 55,284,709 Y1726C probably damaging Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Itgad T A 7: 128,178,371 I141N possibly damaging Het
Kcnh1 C T 1: 192,506,060 T970M probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp1a T A 11: 71,123,630 T265S probably damaging Het
Nsun4 A G 4: 116,052,725 S213P possibly damaging Het
Pkdrej C T 15: 85,817,004 R1577Q probably benign Het
Proz A T 8: 13,061,042 I5F probably benign Het
Rbm48 A T 5: 3,596,043 F54I possibly damaging Het
Rgs20 T C 1: 5,070,053 D42G probably benign Het
Rxfp2 A C 5: 150,043,130 D111A probably benign Het
Sparcl1 T C 5: 104,093,226 T111A possibly damaging Het
Vmn2r14 T A 5: 109,215,910 L713F probably damaging Het
Other mutations in Gad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01794:Gad1 APN 2 70597168 missense probably benign
IGL01907:Gad1 APN 2 70574126 missense possibly damaging 0.64
IGL02596:Gad1 APN 2 70594684 missense probably damaging 1.00
IGL02654:Gad1 APN 2 70572781 missense possibly damaging 0.88
IGL02998:Gad1 APN 2 70589819 missense probably damaging 1.00
PIT4581001:Gad1 UTSW 2 70599667 missense probably benign 0.05
R0102:Gad1 UTSW 2 70587239 critical splice donor site probably null
R0454:Gad1 UTSW 2 70579201 missense probably damaging 1.00
R0576:Gad1 UTSW 2 70594652 missense probably benign 0.27
R1386:Gad1 UTSW 2 70574123 missense possibly damaging 0.88
R1677:Gad1 UTSW 2 70574177 missense probably damaging 1.00
R1842:Gad1 UTSW 2 70574253 missense probably benign 0.12
R1907:Gad1 UTSW 2 70579138 missense possibly damaging 0.79
R1933:Gad1 UTSW 2 70587392 missense possibly damaging 0.91
R4085:Gad1 UTSW 2 70589848 missense probably benign 0.36
R4321:Gad1 UTSW 2 70589830 missense probably damaging 1.00
R4324:Gad1 UTSW 2 70589830 missense probably damaging 1.00
R4687:Gad1 UTSW 2 70600720 missense possibly damaging 0.94
R4986:Gad1 UTSW 2 70600693 missense probably benign
R5387:Gad1 UTSW 2 70563851 nonsense probably null
R5603:Gad1 UTSW 2 70589829 missense probably damaging 0.98
R6500:Gad1 UTSW 2 70593436 missense probably damaging 0.98
R7146:Gad1 UTSW 2 70587362 missense probably benign 0.00
R7352:Gad1 UTSW 2 70594750 missense probably benign 0.00
R7559:Gad1 UTSW 2 70563912 critical splice donor site probably null
R7579:Gad1 UTSW 2 70587132 missense possibly damaging 0.90
R7809:Gad1 UTSW 2 70597259 missense possibly damaging 0.80
X0026:Gad1 UTSW 2 70589866 missense probably benign 0.00
Z1177:Gad1 UTSW 2 70579130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCTGACCTGAGTGGCAG -3'
(R):5'- TAGCCATAGTTCCCAGGCTAG -3'

Sequencing Primer
(F):5'- CCCAAGAGTGTCTTTAAAGGACATC -3'
(R):5'- TAGTTCCCAGGCTAGCCACAG -3'
Posted On2015-02-05