Incidental Mutation 'R3029:Nsun4'
ID265900
Institutional Source Beutler Lab
Gene Symbol Nsun4
Ensembl Gene ENSMUSG00000028706
Gene NameNOL1/NOP2/Sun domain family, member 4
Synonyms
MMRRC Submission 040545-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R3029 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116032842-116053876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116052725 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 213 (S213P)
Ref Sequence ENSEMBL: ENSMUSP00000130430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030474] [ENSMUST00000030475] [ENSMUST00000165493]
Predicted Effect probably benign
Transcript: ENSMUST00000030474
SMART Domains Protein: ENSMUSP00000030474
Gene: ENSMUSG00000028706

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 28 199 3.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030475
SMART Domains Protein: ENSMUSP00000030475
Gene: ENSMUSG00000028706

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:Nol1_Nop2_Fmu 163 356 9.7e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152712
Predicted Effect possibly damaging
Transcript: ENSMUST00000165493
AA Change: S213P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130430
Gene: ENSMUSG00000028706
AA Change: S213P

DomainStartEndE-ValueType
low complexity region 91 124 N/A INTRINSIC
low complexity region 277 290 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
low complexity region 553 565 N/A INTRINSIC
low complexity region 572 596 N/A INTRINSIC
low complexity region 677 700 N/A INTRINSIC
low complexity region 710 723 N/A INTRINSIC
low complexity region 733 756 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,718,245 I213T probably benign Het
Atp8a2 CGT CGTGT 14: 59,691,465 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk6 G A 5: 3,390,817 probably null Het
Cryab T A 9: 50,756,338 I124N probably damaging Het
E2f5 A G 3: 14,603,665 I206V probably benign Het
Eya4 T C 10: 23,123,878 T396A probably benign Het
Fat2 T C 11: 55,284,709 Y1726C probably damaging Het
Gad1 G A 2: 70,594,690 V443I probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Itgad T A 7: 128,178,371 I141N possibly damaging Het
Kcnh1 C T 1: 192,506,060 T970M probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp1a T A 11: 71,123,630 T265S probably damaging Het
Pkdrej C T 15: 85,817,004 R1577Q probably benign Het
Proz A T 8: 13,061,042 I5F probably benign Het
Rbm48 A T 5: 3,596,043 F54I possibly damaging Het
Rgs20 T C 1: 5,070,053 D42G probably benign Het
Rxfp2 A C 5: 150,043,130 D111A probably benign Het
Sparcl1 T C 5: 104,093,226 T111A possibly damaging Het
Vmn2r14 T A 5: 109,215,910 L713F probably damaging Het
Other mutations in Nsun4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0089:Nsun4 UTSW 4 116035773 missense probably benign 0.01
R0306:Nsun4 UTSW 4 116052822 nonsense probably null
R0365:Nsun4 UTSW 4 116044738 missense probably damaging 1.00
R1440:Nsun4 UTSW 4 116052950 missense possibly damaging 0.83
R1624:Nsun4 UTSW 4 116034200 missense probably benign 0.05
R2058:Nsun4 UTSW 4 116053680 splice site probably null
R2262:Nsun4 UTSW 4 116052950 missense probably benign 0.27
R2438:Nsun4 UTSW 4 116048597 missense probably benign 0.01
R4012:Nsun4 UTSW 4 116051062 missense possibly damaging 0.66
R4162:Nsun4 UTSW 4 116034194 nonsense probably null
R4166:Nsun4 UTSW 4 116034051 missense probably damaging 0.98
R4277:Nsun4 UTSW 4 116034282 missense probably damaging 1.00
R4433:Nsun4 UTSW 4 116040130 missense possibly damaging 0.75
R4450:Nsun4 UTSW 4 116051256 nonsense probably null
R5077:Nsun4 UTSW 4 116048584 missense probably benign 0.00
R5307:Nsun4 UTSW 4 116034138 missense probably damaging 0.98
R5509:Nsun4 UTSW 4 116051777 missense possibly damaging 0.46
R5510:Nsun4 UTSW 4 116051777 missense possibly damaging 0.46
R6145:Nsun4 UTSW 4 116040206 missense probably damaging 1.00
R6520:Nsun4 UTSW 4 116044738 missense probably damaging 1.00
R6848:Nsun4 UTSW 4 116052934 missense possibly damaging 0.90
R7346:Nsun4 UTSW 4 116051838 missense probably benign 0.01
R7528:Nsun4 UTSW 4 116034194 nonsense probably null
R7560:Nsun4 UTSW 4 116051494 missense possibly damaging 0.92
R7719:Nsun4 UTSW 4 116052420 missense possibly damaging 0.82
R7798:Nsun4 UTSW 4 116051174 missense possibly damaging 0.83
R7868:Nsun4 UTSW 4 116034132 missense probably benign
R7951:Nsun4 UTSW 4 116034132 missense probably benign
R8074:Nsun4 UTSW 4 116051434 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGGGGAGGATCATTGTAACTTCTTC -3'
(R):5'- ATTCAGCCTTCAGGGGTCAC -3'

Sequencing Primer
(F):5'- AACTTCTTCTAGAGGGACAGTGG -3'
(R):5'- TCCTCATCAGCGGAACCTATG -3'
Posted On2015-02-05