Incidental Mutation 'R3029:Cdk6'
ID265901
Institutional Source Beutler Lab
Gene Symbol Cdk6
Ensembl Gene ENSMUSG00000040274
Gene Namecyclin-dependent kinase 6
SynonymsCrk2
MMRRC Submission 040545-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3029 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3341485-3531008 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 3390817 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042410] [ENSMUST00000165117] [ENSMUST00000197385]
Predicted Effect probably null
Transcript: ENSMUST00000042410
SMART Domains Protein: ENSMUSP00000037925
Gene: ENSMUSG00000040274

DomainStartEndE-ValueType
S_TKc 13 300 4.26e-100 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165117
SMART Domains Protein: ENSMUSP00000126024
Gene: ENSMUSG00000040274

DomainStartEndE-ValueType
S_TKc 13 300 4.26e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197385
SMART Domains Protein: ENSMUSP00000143492
Gene: ENSMUSG00000040274

DomainStartEndE-ValueType
Pfam:Pkinase 13 82 2.4e-11 PFAM
Pfam:Pkinase_Tyr 13 82 1.3e-5 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cyclin dependent kinase family of proteins that play important roles in the progression and regulation of the cell cycle. The encoded protein binds to a D-type cyclin to form an active kinase complex to regulate progression through the G1 phase of the cell cycle. Mice lacking the encoded protein exhibit thymic and splenic hypoplasia, and hematopoietic defects such as reduced number of megakaryocytes and erythrocytes. A pseudogene of this gene has been defined on chromosome 4. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display hematopoietic abnormalities affecting spleen and thymus size. Female body weight and fertility are also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,718,245 I213T probably benign Het
Atp8a2 CGT CGTGT 14: 59,691,465 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cryab T A 9: 50,756,338 I124N probably damaging Het
E2f5 A G 3: 14,603,665 I206V probably benign Het
Eya4 T C 10: 23,123,878 T396A probably benign Het
Fat2 T C 11: 55,284,709 Y1726C probably damaging Het
Gad1 G A 2: 70,594,690 V443I probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Itgad T A 7: 128,178,371 I141N possibly damaging Het
Kcnh1 C T 1: 192,506,060 T970M probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp1a T A 11: 71,123,630 T265S probably damaging Het
Nsun4 A G 4: 116,052,725 S213P possibly damaging Het
Pkdrej C T 15: 85,817,004 R1577Q probably benign Het
Proz A T 8: 13,061,042 I5F probably benign Het
Rbm48 A T 5: 3,596,043 F54I possibly damaging Het
Rgs20 T C 1: 5,070,053 D42G probably benign Het
Rxfp2 A C 5: 150,043,130 D111A probably benign Het
Sparcl1 T C 5: 104,093,226 T111A possibly damaging Het
Vmn2r14 T A 5: 109,215,910 L713F probably damaging Het
Other mutations in Cdk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Cdk6 UTSW 5 3344211 start gained probably benign
R0583:Cdk6 UTSW 5 3473183 missense probably damaging 0.99
R1474:Cdk6 UTSW 5 3473217 missense probably benign 0.23
R1538:Cdk6 UTSW 5 3520675 missense probably benign 0.02
R2104:Cdk6 UTSW 5 3344387 missense probably benign 0.16
R4886:Cdk6 UTSW 5 3344444 missense possibly damaging 0.82
R4939:Cdk6 UTSW 5 3344377 missense probably null 0.99
R5421:Cdk6 UTSW 5 3473120 missense probably damaging 1.00
R5583:Cdk6 UTSW 5 3344436 missense probably damaging 1.00
R6247:Cdk6 UTSW 5 3344553 unclassified probably null
R7014:Cdk6 UTSW 5 3473152 missense probably damaging 1.00
R7102:Cdk6 UTSW 5 3520709 missense probably damaging 1.00
R7288:Cdk6 UTSW 5 3429001 missense probably benign
Z1176:Cdk6 UTSW 5 3390694 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CGCATGCGTTACTACTTGAC -3'
(R):5'- GGACTACAACCCCACTCTTTG -3'

Sequencing Primer
(F):5'- GCATGCGTTACTACTTGACTTATTTC -3'
(R):5'- CTTTGAAGATCCCACTTAACAGAGG -3'
Posted On2015-02-05