Incidental Mutation 'R3029:Rbm48'
ID265902
Institutional Source Beutler Lab
Gene Symbol Rbm48
Ensembl Gene ENSMUSG00000040302
Gene NameRNA binding motif protein 48
SynonymsC030048B08Rik
MMRRC Submission 040545-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R3029 (G1)
Quality Score182
Status Not validated
Chromosome5
Chromosomal Location3583978-3596585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3596043 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 54 (F54I)
Ref Sequence ENSEMBL: ENSMUSP00000040952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006061] [ENSMUST00000042753] [ENSMUST00000121291] [ENSMUST00000121877] [ENSMUST00000142516] [ENSMUST00000195894]
Predicted Effect probably benign
Transcript: ENSMUST00000006061
SMART Domains Protein: ENSMUSP00000006061
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 14 99 2.4e-53 PFAM
Pfam:PEX-1N 103 179 8.6e-27 PFAM
low complexity region 508 527 N/A INTRINSIC
AAA 552 702 1.39e-10 SMART
low complexity region 754 765 N/A INTRINSIC
AAA 834 970 4.07e-17 SMART
low complexity region 1024 1044 N/A INTRINSIC
low complexity region 1051 1061 N/A INTRINSIC
low complexity region 1065 1078 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000042753
AA Change: F54I

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040952
Gene: ENSMUSG00000040302
AA Change: F54I

DomainStartEndE-ValueType
Pfam:RRM_5 104 164 6.5e-11 PFAM
low complexity region 229 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121291
SMART Domains Protein: ENSMUSP00000113304
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 17 98 8.7e-38 PFAM
Pfam:PEX-1N 104 179 1.4e-27 PFAM
low complexity region 548 567 N/A INTRINSIC
AAA 592 742 1.39e-10 SMART
low complexity region 794 805 N/A INTRINSIC
AAA 874 1010 4.07e-17 SMART
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1091 1101 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121877
AA Change: F54I

PolyPhen 2 Score 0.359 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112547
Gene: ENSMUSG00000040302
AA Change: F54I

DomainStartEndE-ValueType
Blast:RRM 52 106 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135809
Predicted Effect probably benign
Transcript: ENSMUST00000142516
SMART Domains Protein: ENSMUSP00000116474
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
PDB:1WLF|A 1 21 5e-8 PDB
Predicted Effect unknown
Transcript: ENSMUST00000176000
AA Change: F6I
Predicted Effect probably benign
Transcript: ENSMUST00000195894
SMART Domains Protein: ENSMUSP00000142620
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 14 99 2.5e-51 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,718,245 I213T probably benign Het
Atp8a2 CGT CGTGT 14: 59,691,465 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk6 G A 5: 3,390,817 probably null Het
Cryab T A 9: 50,756,338 I124N probably damaging Het
E2f5 A G 3: 14,603,665 I206V probably benign Het
Eya4 T C 10: 23,123,878 T396A probably benign Het
Fat2 T C 11: 55,284,709 Y1726C probably damaging Het
Gad1 G A 2: 70,594,690 V443I probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Itgad T A 7: 128,178,371 I141N possibly damaging Het
Kcnh1 C T 1: 192,506,060 T970M probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp1a T A 11: 71,123,630 T265S probably damaging Het
Nsun4 A G 4: 116,052,725 S213P possibly damaging Het
Pkdrej C T 15: 85,817,004 R1577Q probably benign Het
Proz A T 8: 13,061,042 I5F probably benign Het
Rgs20 T C 1: 5,070,053 D42G probably benign Het
Rxfp2 A C 5: 150,043,130 D111A probably benign Het
Sparcl1 T C 5: 104,093,226 T111A possibly damaging Het
Vmn2r14 T A 5: 109,215,910 L713F probably damaging Het
Other mutations in Rbm48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Rbm48 APN 5 3591739 missense probably damaging 0.99
IGL01085:Rbm48 APN 5 3584762 missense probably benign 0.38
IGL02605:Rbm48 APN 5 3590600 missense possibly damaging 0.53
R0811:Rbm48 UTSW 5 3591760 unclassified probably null
R0812:Rbm48 UTSW 5 3591760 unclassified probably null
R0862:Rbm48 UTSW 5 3590438 missense probably benign 0.34
R1866:Rbm48 UTSW 5 3595997 missense probably damaging 1.00
R1876:Rbm48 UTSW 5 3595259 missense probably damaging 1.00
R3159:Rbm48 UTSW 5 3596105 missense possibly damaging 0.87
R4385:Rbm48 UTSW 5 3590300 missense probably damaging 1.00
R4878:Rbm48 UTSW 5 3591853 unclassified probably benign
R5176:Rbm48 UTSW 5 3595444 missense probably damaging 1.00
R5276:Rbm48 UTSW 5 3584759 missense probably benign
R6812:Rbm48 UTSW 5 3596105 missense probably benign 0.23
R7059:Rbm48 UTSW 5 3590625 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGATAACCTTTGGTACCGGGG -3'
(R):5'- CTCTCAGGAGATGATCGTCGATG -3'

Sequencing Primer
(F):5'- GATGGATCTCACAACATCCCTG -3'
(R):5'- ATGGGGTCGATCCTTCAGC -3'
Posted On2015-02-05