Incidental Mutation 'R3029:Proz'
ID265908
Institutional Source Beutler Lab
Gene Symbol Proz
Ensembl Gene ENSMUSG00000031445
Gene Nameprotein Z, vitamin K-dependent plasma glycoprotein
Synonyms
MMRRC Submission 040545-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R3029 (G1)
Quality Score155
Status Not validated
Chromosome8
Chromosomal Location13060914-13076026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13061042 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 5 (I5F)
Ref Sequence ENSEMBL: ENSMUSP00000147328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033822] [ENSMUST00000063820] [ENSMUST00000211363] [ENSMUST00000211453]
Predicted Effect probably benign
Transcript: ENSMUST00000033822
AA Change: I5F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033822
Gene: ENSMUSG00000031445
AA Change: I5F

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
GLA 22 86 7.03e-29 SMART
EGF 90 123 1.65e-6 SMART
EGF 128 166 1.19e-3 SMART
Tryp_SPc 182 394 6.49e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063820
SMART Domains Protein: ENSMUSP00000068389
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Tryp_SPc 231 459 9.03e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210050
Predicted Effect probably benign
Transcript: ENSMUST00000211363
AA Change: I5F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211453
AA Change: I5F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a liver vitamin K-dependent glycoprotein that is synthesized in the liver and secreted into the plasma. The encoded protein plays a role in regulating blood coagulation by complexing with protein Z-dependent protease inhibitor to directly inhibit activated factor X at the phospholipid surface. Deficiencies in this protein are associated with an increased risk of ischemic arterial diseases and fetal loss. Mutations in this gene are the cause of protein Z deficiency. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: When unchallenged, mice homozygous for a knock-out allele do not express an obvious phenotype; however, homozygotes exhibit significantly reduced survival following collagen/epinephrine-induced thromboembolism and develop enhanced thrombosis in the ferric chloride-induced arterial injury model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,718,245 I213T probably benign Het
Atp8a2 CGT CGTGT 14: 59,691,465 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk6 G A 5: 3,390,817 probably null Het
Cryab T A 9: 50,756,338 I124N probably damaging Het
E2f5 A G 3: 14,603,665 I206V probably benign Het
Eya4 T C 10: 23,123,878 T396A probably benign Het
Fat2 T C 11: 55,284,709 Y1726C probably damaging Het
Gad1 G A 2: 70,594,690 V443I probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Itgad T A 7: 128,178,371 I141N possibly damaging Het
Kcnh1 C T 1: 192,506,060 T970M probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp1a T A 11: 71,123,630 T265S probably damaging Het
Nsun4 A G 4: 116,052,725 S213P possibly damaging Het
Pkdrej C T 15: 85,817,004 R1577Q probably benign Het
Rbm48 A T 5: 3,596,043 F54I possibly damaging Het
Rgs20 T C 1: 5,070,053 D42G probably benign Het
Rxfp2 A C 5: 150,043,130 D111A probably benign Het
Sparcl1 T C 5: 104,093,226 T111A possibly damaging Het
Vmn2r14 T A 5: 109,215,910 L713F probably damaging Het
Other mutations in Proz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Proz APN 8 13065238 splice site probably benign
IGL01977:Proz APN 8 13066913 missense probably damaging 1.00
IGL02553:Proz APN 8 13065260 missense probably benign 0.00
IGL02991:Proz UTSW 8 13073490 missense probably benign 0.00
R0241:Proz UTSW 8 13065356 missense probably benign 0.02
R0241:Proz UTSW 8 13065356 missense probably benign 0.02
R0482:Proz UTSW 8 13073460 nonsense probably null
R1614:Proz UTSW 8 13066904 missense probably damaging 1.00
R1906:Proz UTSW 8 13073686 splice site probably null
R2230:Proz UTSW 8 13063356 missense probably damaging 0.99
R2232:Proz UTSW 8 13063356 missense probably damaging 0.99
R2444:Proz UTSW 8 13061027 start gained probably benign
R3847:Proz UTSW 8 13073533 missense probably benign 0.00
R3850:Proz UTSW 8 13073533 missense probably benign 0.00
R4063:Proz UTSW 8 13064621 missense probably damaging 1.00
R5104:Proz UTSW 8 13066931 missense probably damaging 1.00
R5309:Proz UTSW 8 13061049 missense probably damaging 1.00
R5337:Proz UTSW 8 13066854 missense probably benign 0.01
R5447:Proz UTSW 8 13072578 missense probably benign 0.31
R5876:Proz UTSW 8 13073448 missense probably benign 0.05
R6739:Proz UTSW 8 13073451 missense possibly damaging 0.86
R7559:Proz UTSW 8 13063455 missense probably benign 0.01
R7842:Proz UTSW 8 13063406 missense probably benign 0.19
R7867:Proz UTSW 8 13061027 start gained probably benign
R8676:Proz UTSW 8 13073630 missense probably damaging 1.00
R8820:Proz UTSW 8 13063253 missense probably damaging 1.00
R8936:Proz UTSW 8 13065319 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATGAGAGTGAGCCTCCTCC -3'
(R):5'- ACCATTGAGTGTCCCAAGGATG -3'

Sequencing Primer
(F):5'- AGTGAGCCTCCTCCCCGAG -3'
(R):5'- TAGTAAGTCCTAGACCAGCTTGAGC -3'
Posted On2015-02-05