Incidental Mutation 'R3029:Cryab'
ID265910
Institutional Source Beutler Lab
Gene Symbol Cryab
Ensembl Gene ENSMUSG00000032060
Gene Namecrystallin, alpha B
SynonymsCrya2, alpha B-crystallin, HspB5, Crya-2
MMRRC Submission 040545-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R3029 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location50751325-50756636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50756338 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 124 (I124N)
Ref Sequence ENSEMBL: ENSMUSP00000149454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034562] [ENSMUST00000042790] [ENSMUST00000214609] [ENSMUST00000214962] [ENSMUST00000216755] [ENSMUST00000217159] [ENSMUST00000217475]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034562
AA Change: I124N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034562
Gene: ENSMUSG00000032060
AA Change: I124N

DomainStartEndE-ValueType
Pfam:Crystallin 1 56 7.3e-32 PFAM
Pfam:HSP20 67 162 2.1e-27 PFAM
low complexity region 166 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042790
SMART Domains Protein: ENSMUSP00000042374
Gene: ENSMUSG00000038086

DomainStartEndE-ValueType
Pfam:Crystallin 14 55 1.6e-8 PFAM
Pfam:HSP20 66 163 5.7e-19 PFAM
low complexity region 166 182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214609
AA Change: I124N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214962
AA Change: I124N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216393
Predicted Effect possibly damaging
Transcript: ENSMUST00000216755
AA Change: I124N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000217159
Predicted Effect possibly damaging
Transcript: ENSMUST00000217475
AA Change: I124N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the small heat-shock protein (HSP20) family. The encoded protein is a molecular chaperone that protects proteins against thermal denaturation and other stresses. This protein is a component of the eye lens, regulates lens differentiation and functions as a refractive element in the lens. This protein is a negative regulator of inflammation, has anti-apoptotic properties and also plays a role in the formation of muscular tissue. Mice lacking this gene exhibit worse experimental autoimmune encephalomyelitis and inflammation of the central nervous system compared to the wild type. In mouse models, this gene has a critical role in alleviating the pathology of the neurodegenerative Alexander disease. Mutations in the human gene are associated with myofibrillar myopathy 2, fatal infantile hypertonic myofibrillar myopathy, multiple types of cataract and dilated cardiomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous or heterozygous for a knock-in allele exhibit decreased grip strength and develop cataracts and myopathy; some mice display unilateral corneal abnormalities and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,718,245 I213T probably benign Het
Atp8a2 CGT CGTGT 14: 59,691,465 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk6 G A 5: 3,390,817 probably null Het
E2f5 A G 3: 14,603,665 I206V probably benign Het
Eya4 T C 10: 23,123,878 T396A probably benign Het
Fat2 T C 11: 55,284,709 Y1726C probably damaging Het
Gad1 G A 2: 70,594,690 V443I probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Itgad T A 7: 128,178,371 I141N possibly damaging Het
Kcnh1 C T 1: 192,506,060 T970M probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp1a T A 11: 71,123,630 T265S probably damaging Het
Nsun4 A G 4: 116,052,725 S213P possibly damaging Het
Pkdrej C T 15: 85,817,004 R1577Q probably benign Het
Proz A T 8: 13,061,042 I5F probably benign Het
Rbm48 A T 5: 3,596,043 F54I possibly damaging Het
Rgs20 T C 1: 5,070,053 D42G probably benign Het
Rxfp2 A C 5: 150,043,130 D111A probably benign Het
Sparcl1 T C 5: 104,093,226 T111A possibly damaging Het
Vmn2r14 T A 5: 109,215,910 L713F probably damaging Het
Other mutations in Cryab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Cryab APN 9 50754555 missense probably damaging 1.00
R4999:Cryab UTSW 9 50754609 missense possibly damaging 0.92
R5355:Cryab UTSW 9 50753451 missense probably damaging 1.00
R5427:Cryab UTSW 9 50756293 missense probably damaging 1.00
R6192:Cryab UTSW 9 50754513 missense probably damaging 0.97
R6272:Cryab UTSW 9 50754525 missense possibly damaging 0.80
R6993:Cryab UTSW 9 50753448 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTATCCCCAGCTCCGGATATC -3'
(R):5'- TTTCAATCACTGATGGGAAACTTCC -3'

Sequencing Primer
(F):5'- CGGATATCTCTTTTTATCTTAGGGC -3'
(R):5'- AAAAACTCAATGAGGAAAGGGGATC -3'
Posted On2015-02-05