Incidental Mutation 'R3029:Eya4'
ID265911
Institutional Source Beutler Lab
Gene Symbol Eya4
Ensembl Gene ENSMUSG00000010461
Gene NameEYA transcriptional coactivator and phosphatase 4
SynonymsB130023L16Rik
MMRRC Submission 040545-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3029 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23102963-23350786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23123878 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 396 (T396A)
Ref Sequence ENSEMBL: ENSMUSP00000151287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074366] [ENSMUST00000092665] [ENSMUST00000219315] [ENSMUST00000220299]
Predicted Effect probably benign
Transcript: ENSMUST00000074366
AA Change: T396A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073970
Gene: ENSMUSG00000010461
AA Change: T396A

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-163 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000092665
AA Change: T396A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090335
Gene: ENSMUSG00000010461
AA Change: T396A

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-172 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000219315
AA Change: T419A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220299
AA Change: T396A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant non-syndromic sensorineural 10 locus. The encoded protein is also a putative oncogene that mediates DNA repair, apoptosis, and innate immunity following DNA damage, cellular damage, and viral attack. Defects in this gene are also associated with dilated cardiomyopathy 1J. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show strain background-dependent postnatal lethality, reduced body weight, male sterility, a delay in palate bone fusion, developmental defects in the eustachian tube and middle ear cavity, early-onset hearing deficits, and profound susceptibility to otitis media with effusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,718,245 I213T probably benign Het
Atp8a2 CGT CGTGT 14: 59,691,465 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk6 G A 5: 3,390,817 probably null Het
Cryab T A 9: 50,756,338 I124N probably damaging Het
E2f5 A G 3: 14,603,665 I206V probably benign Het
Fat2 T C 11: 55,284,709 Y1726C probably damaging Het
Gad1 G A 2: 70,594,690 V443I probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Itgad T A 7: 128,178,371 I141N possibly damaging Het
Kcnh1 C T 1: 192,506,060 T970M probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp1a T A 11: 71,123,630 T265S probably damaging Het
Nsun4 A G 4: 116,052,725 S213P possibly damaging Het
Pkdrej C T 15: 85,817,004 R1577Q probably benign Het
Proz A T 8: 13,061,042 I5F probably benign Het
Rbm48 A T 5: 3,596,043 F54I possibly damaging Het
Rgs20 T C 1: 5,070,053 D42G probably benign Het
Rxfp2 A C 5: 150,043,130 D111A probably benign Het
Sparcl1 T C 5: 104,093,226 T111A possibly damaging Het
Vmn2r14 T A 5: 109,215,910 L713F probably damaging Het
Other mutations in Eya4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Eya4 APN 10 23159097 missense probably benign 0.17
IGL00507:Eya4 APN 10 23157536 nonsense probably null
IGL01324:Eya4 APN 10 23116551 critical splice donor site probably null
IGL01350:Eya4 APN 10 23113974 missense possibly damaging 0.88
IGL01397:Eya4 APN 10 23139999 missense probably benign 0.01
IGL02682:Eya4 APN 10 23116600 missense probably damaging 1.00
IGL02688:Eya4 APN 10 23159110 missense probably benign 0.01
IGL03071:Eya4 APN 10 23323073 missense probably benign 0.07
R0420:Eya4 UTSW 10 23155963 missense possibly damaging 0.85
R1688:Eya4 UTSW 10 23123861 missense probably damaging 1.00
R2312:Eya4 UTSW 10 23106264 missense probably damaging 1.00
R3853:Eya4 UTSW 10 23116676 missense probably damaging 1.00
R3872:Eya4 UTSW 10 23155972 missense probably damaging 0.97
R4113:Eya4 UTSW 10 23155951 missense probably damaging 0.98
R4210:Eya4 UTSW 10 23226800 critical splice donor site probably null
R4457:Eya4 UTSW 10 23116668 missense probably damaging 1.00
R4691:Eya4 UTSW 10 23140068 missense probably benign 0.03
R4894:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5345:Eya4 UTSW 10 23110048 missense probably benign 0.00
R5473:Eya4 UTSW 10 23163453 missense probably benign 0.02
R5547:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5698:Eya4 UTSW 10 23140077 missense possibly damaging 0.50
R5951:Eya4 UTSW 10 23155994 missense probably damaging 1.00
R5953:Eya4 UTSW 10 23151973 missense probably damaging 1.00
R6111:Eya4 UTSW 10 23140055 missense possibly damaging 0.67
R6413:Eya4 UTSW 10 23116826 missense probably damaging 1.00
R6460:Eya4 UTSW 10 23152012 missense probably benign 0.05
R7144:Eya4 UTSW 10 23173045 missense probably benign 0.00
R7169:Eya4 UTSW 10 23155947 missense probably benign 0.42
R7358:Eya4 UTSW 10 23123851 critical splice donor site probably null
R7549:Eya4 UTSW 10 23111658 missense probably damaging 1.00
R7791:Eya4 UTSW 10 23113926 missense probably damaging 1.00
R7793:Eya4 UTSW 10 23226816 missense probably benign
Z1088:Eya4 UTSW 10 23113988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCACTTGACAAGAACTTTACAG -3'
(R):5'- AGAGATCCATGTTTGAGAATCATTC -3'

Sequencing Primer
(F):5'- AGAACTTTACAGCTCTTGGGAG -3'
(R):5'- CTCCCTTACTGCTGGAAAAATG -3'
Posted On2015-02-05