Incidental Mutation 'R3029:Nlrp1a'
ID265913
Institutional Source Beutler Lab
Gene Symbol Nlrp1a
Ensembl Gene ENSMUSG00000069830
Gene NameNLR family, pyrin domain containing 1A
SynonymsNalp1
MMRRC Submission 040545-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R3029 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location71092236-71144704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71123630 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 265 (T265S)
Ref Sequence ENSEMBL: ENSMUSP00000104158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048514] [ENSMUST00000108518]
Predicted Effect probably damaging
Transcript: ENSMUST00000048514
AA Change: T265S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038186
Gene: ENSMUSG00000069830
AA Change: T265S

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NACHT 133 302 4.6e-41 PFAM
low complexity region 482 494 N/A INTRINSIC
LRR 632 659 4.53e-1 SMART
LRR 742 769 3.04e-5 SMART
low complexity region 856 870 N/A INTRINSIC
Pfam:FIIND 921 1173 1.6e-102 PFAM
Pfam:CARD 1209 1292 2.3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108518
AA Change: T265S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104158
Gene: ENSMUSG00000069830
AA Change: T265S

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NACHT 133 302 1.1e-40 PFAM
low complexity region 482 494 N/A INTRINSIC
LRR 632 659 4.53e-1 SMART
LRR 661 688 2.85e1 SMART
LRR 689 716 3.04e-5 SMART
Pfam:FIIND 819 1073 3e-136 PFAM
Pfam:CARD 1091 1174 8.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for an ENU-induced allele develop a multi-organ neutrophilic inflammatory disease. Homozygotes for the same ENU-induced allele develop a similar but lethal condition and exhibit neutrophilia, lymphopenia, splenomegaly, loss of peritoneal macrophages, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,718,245 I213T probably benign Het
Atp8a2 CGT CGTGT 14: 59,691,465 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk6 G A 5: 3,390,817 probably null Het
Cryab T A 9: 50,756,338 I124N probably damaging Het
E2f5 A G 3: 14,603,665 I206V probably benign Het
Eya4 T C 10: 23,123,878 T396A probably benign Het
Fat2 T C 11: 55,284,709 Y1726C probably damaging Het
Gad1 G A 2: 70,594,690 V443I probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Itgad T A 7: 128,178,371 I141N possibly damaging Het
Kcnh1 C T 1: 192,506,060 T970M probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nsun4 A G 4: 116,052,725 S213P possibly damaging Het
Pkdrej C T 15: 85,817,004 R1577Q probably benign Het
Proz A T 8: 13,061,042 I5F probably benign Het
Rbm48 A T 5: 3,596,043 F54I possibly damaging Het
Rgs20 T C 1: 5,070,053 D42G probably benign Het
Rxfp2 A C 5: 150,043,130 D111A probably benign Het
Sparcl1 T C 5: 104,093,226 T111A possibly damaging Het
Vmn2r14 T A 5: 109,215,910 L713F probably damaging Het
Other mutations in Nlrp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Nlrp1a APN 11 71092957 missense probably benign 0.00
IGL00771:Nlrp1a APN 11 71122741 nonsense probably null
IGL01408:Nlrp1a APN 11 71122916 missense probably benign 0.04
IGL01886:Nlrp1a APN 11 71123501 missense probably benign
IGL02221:Nlrp1a APN 11 71123118 missense possibly damaging 0.88
IGL02291:Nlrp1a APN 11 71122589 critical splice donor site probably null
IGL02375:Nlrp1a APN 11 71113513 nonsense probably null
IGL02408:Nlrp1a APN 11 71122630 missense probably benign 0.00
IGL02516:Nlrp1a APN 11 71114460 missense probably damaging 1.00
IGL02583:Nlrp1a APN 11 71123401 missense probably benign 0.03
IGL02622:Nlrp1a APN 11 71123000 missense possibly damaging 0.88
IGL02642:Nlrp1a APN 11 71123532 missense probably benign 0.12
IGL02823:Nlrp1a APN 11 71092423 missense probably damaging 0.96
IGL02859:Nlrp1a APN 11 71106086 missense possibly damaging 0.57
IGL02997:Nlrp1a APN 11 71123665 missense probably damaging 1.00
IGL03342:Nlrp1a APN 11 71122791 missense probably benign 0.19
Ants UTSW 11 71142338 missense probably benign 0.01
dreary UTSW 11 71113640 critical splice acceptor site probably null
picnic UTSW 11 71122747 missense possibly damaging 0.87
seedless UTSW 11 71123552 missense probably benign 0.44
watermelon UTSW 11 71122705 missense probably benign 0.08
R0022:Nlrp1a UTSW 11 71123381 missense probably damaging 0.99
R0345:Nlrp1a UTSW 11 71123675 missense probably damaging 1.00
R0360:Nlrp1a UTSW 11 71114004 intron probably benign
R0364:Nlrp1a UTSW 11 71114004 intron probably benign
R0566:Nlrp1a UTSW 11 71122942 missense probably benign 0.00
R1177:Nlrp1a UTSW 11 71107721 missense probably damaging 1.00
R1240:Nlrp1a UTSW 11 71113466 critical splice donor site probably null
R1263:Nlrp1a UTSW 11 71097122 missense probably benign 0.01
R1681:Nlrp1a UTSW 11 71142358 missense unknown
R1743:Nlrp1a UTSW 11 71124206 missense probably benign 0.04
R1826:Nlrp1a UTSW 11 71107980 intron probably benign
R1826:Nlrp1a UTSW 11 71122747 missense possibly damaging 0.87
R1981:Nlrp1a UTSW 11 71098938 missense probably damaging 1.00
R2083:Nlrp1a UTSW 11 71124220 missense possibly damaging 0.59
R2116:Nlrp1a UTSW 11 71114500 nonsense probably null
R2134:Nlrp1a UTSW 11 71124188 missense probably benign 0.00
R2148:Nlrp1a UTSW 11 71122907 nonsense probably null
R2301:Nlrp1a UTSW 11 71106101 missense possibly damaging 0.94
R3113:Nlrp1a UTSW 11 71123665 missense probably damaging 1.00
R3801:Nlrp1a UTSW 11 71122703 missense probably benign 0.08
R3898:Nlrp1a UTSW 11 71122874 missense probably benign 0.00
R4254:Nlrp1a UTSW 11 71123028 nonsense probably null
R4397:Nlrp1a UTSW 11 71097204 missense probably benign 0.00
R4647:Nlrp1a UTSW 11 71097126 splice site probably null
R4740:Nlrp1a UTSW 11 71113640 critical splice acceptor site probably null
R4965:Nlrp1a UTSW 11 71092315 missense possibly damaging 0.94
R5009:Nlrp1a UTSW 11 71122705 missense probably benign 0.08
R5103:Nlrp1a UTSW 11 71099526 missense probably damaging 0.99
R5355:Nlrp1a UTSW 11 71124251 missense probably benign 0.00
R5577:Nlrp1a UTSW 11 71099574 missense probably damaging 1.00
R5892:Nlrp1a UTSW 11 71099645 missense probably damaging 1.00
R5949:Nlrp1a UTSW 11 71098989 missense probably damaging 1.00
R5964:Nlrp1a UTSW 11 71123020 missense probably benign 0.00
R6220:Nlrp1a UTSW 11 71142338 missense probably benign 0.01
R6564:Nlrp1a UTSW 11 71123572 missense probably damaging 1.00
R6586:Nlrp1a UTSW 11 71106073 missense probably benign 0.00
R6925:Nlrp1a UTSW 11 71092513 missense probably null 0.99
R7013:Nlrp1a UTSW 11 71123552 missense probably benign 0.44
R7155:Nlrp1a UTSW 11 71124079 missense possibly damaging 0.93
R7214:Nlrp1a UTSW 11 71123293 missense probably damaging 1.00
R7268:Nlrp1a UTSW 11 71124242 missense probably benign 0.00
R7388:Nlrp1a UTSW 11 71123197 missense probably damaging 1.00
R7404:Nlrp1a UTSW 11 71097093 nonsense probably null
R7409:Nlrp1a UTSW 11 71122808 missense probably benign 0.03
R7410:Nlrp1a UTSW 11 71123857 missense probably damaging 0.99
R7440:Nlrp1a UTSW 11 71092324 missense probably damaging 0.99
R7447:Nlrp1a UTSW 11 71092411 missense probably damaging 1.00
R7450:Nlrp1a UTSW 11 71107658 missense probably damaging 1.00
R7569:Nlrp1a UTSW 11 71109043 missense probably benign 0.00
R7600:Nlrp1a UTSW 11 71098914 missense probably damaging 0.96
R7634:Nlrp1a UTSW 11 71099528 missense probably benign 0.19
R7734:Nlrp1a UTSW 11 71108000 missense unknown
R7747:Nlrp1a UTSW 11 71123408 missense possibly damaging 0.85
X0026:Nlrp1a UTSW 11 71142316 missense probably benign 0.18
Z1177:Nlrp1a UTSW 11 71123169 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGTCAGGAGCGCTGAGTTTG -3'
(R):5'- CTGGCTGAGCTCATAGTACAAGG -3'

Sequencing Primer
(F):5'- CAGGAGCGCTGAGTTTGATTTAAC -3'
(R):5'- AGCTCCCATTAGGCAGATCCTG -3'
Posted On2015-02-05