Incidental Mutation 'R3029:Atp8a2'
ID265916
Institutional Source Beutler Lab
Gene Symbol Atp8a2
Ensembl Gene ENSMUSG00000021983
Gene NameATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonymswl, Ib
MMRRC Submission 040545-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R3029 (G1)
Quality Score188
Status Not validated
Chromosome14
Chromosomal Location59638540-60197179 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGT to CGTGT at 59691465 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080368]
Predicted Effect probably null
Transcript: ENSMUST00000080368
SMART Domains Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 14 80 2.3e-27 PFAM
Pfam:E1-E2_ATPase 85 348 6.7e-15 PFAM
Pfam:HAD 385 790 3.2e-22 PFAM
Pfam:Cation_ATPase 465 564 3.2e-14 PFAM
Pfam:PhoLip_ATPase_C 807 1059 2.8e-79 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,718,245 I213T probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk6 G A 5: 3,390,817 probably null Het
Cryab T A 9: 50,756,338 I124N probably damaging Het
E2f5 A G 3: 14,603,665 I206V probably benign Het
Eya4 T C 10: 23,123,878 T396A probably benign Het
Fat2 T C 11: 55,284,709 Y1726C probably damaging Het
Gad1 G A 2: 70,594,690 V443I probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Itgad T A 7: 128,178,371 I141N possibly damaging Het
Kcnh1 C T 1: 192,506,060 T970M probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp1a T A 11: 71,123,630 T265S probably damaging Het
Nsun4 A G 4: 116,052,725 S213P possibly damaging Het
Pkdrej C T 15: 85,817,004 R1577Q probably benign Het
Proz A T 8: 13,061,042 I5F probably benign Het
Rbm48 A T 5: 3,596,043 F54I possibly damaging Het
Rgs20 T C 1: 5,070,053 D42G probably benign Het
Rxfp2 A C 5: 150,043,130 D111A probably benign Het
Sparcl1 T C 5: 104,093,226 T111A possibly damaging Het
Vmn2r14 T A 5: 109,215,910 L713F probably damaging Het
Other mutations in Atp8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Atp8a2 APN 14 59691461 missense probably benign 0.00
IGL01505:Atp8a2 APN 14 60028063 missense probably benign 0.00
IGL01614:Atp8a2 APN 14 60044988 missense probably damaging 0.99
IGL01621:Atp8a2 APN 14 60015868 splice site probably benign
IGL01634:Atp8a2 APN 14 59998062 missense probably benign 0.01
IGL01672:Atp8a2 APN 14 59691533 missense probably benign 0.01
IGL01898:Atp8a2 APN 14 60023513 missense probably damaging 1.00
IGL01945:Atp8a2 APN 14 60026160 missense probably damaging 1.00
IGL02006:Atp8a2 APN 14 59857048 missense possibly damaging 0.90
IGL02089:Atp8a2 APN 14 60026920 splice site probably null
IGL02211:Atp8a2 APN 14 60027976 missense probably benign 0.00
IGL02283:Atp8a2 APN 14 60016799 missense possibly damaging 0.86
IGL02337:Atp8a2 APN 14 59998002 missense probably benign 0.32
IGL02571:Atp8a2 APN 14 60012458 splice site probably benign
IGL02795:Atp8a2 APN 14 60033742 missense probably damaging 0.96
IGL02874:Atp8a2 APN 14 59802252 missense probably damaging 1.00
IGL02999:Atp8a2 APN 14 59925122 nonsense probably null
IGL03307:Atp8a2 APN 14 60015872 critical splice donor site probably null
IGL03345:Atp8a2 APN 14 59774011 missense probably benign
PIT4431001:Atp8a2 UTSW 14 59654626 missense probably benign
R0334:Atp8a2 UTSW 14 59691512 missense probably damaging 1.00
R0368:Atp8a2 UTSW 14 59860212 missense probably damaging 1.00
R0420:Atp8a2 UTSW 14 59773744 missense probably damaging 1.00
R0684:Atp8a2 UTSW 14 60023144 missense probably benign 0.00
R0755:Atp8a2 UTSW 14 60009881 missense possibly damaging 0.96
R0853:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0908:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0991:Atp8a2 UTSW 14 59793929 missense probably benign 0.33
R1025:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1190:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1387:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1426:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1442:Atp8a2 UTSW 14 59860323 splice site probably benign
R1472:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1538:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1573:Atp8a2 UTSW 14 59860206 missense probably benign 0.00
R1620:Atp8a2 UTSW 14 59791183 missense probably benign
R1661:Atp8a2 UTSW 14 59860186 missense possibly damaging 0.80
R1673:Atp8a2 UTSW 14 59791240 missense probably benign 0.00
R1749:Atp8a2 UTSW 14 59860174 nonsense probably null
R1796:Atp8a2 UTSW 14 60020758 critical splice donor site probably null
R1815:Atp8a2 UTSW 14 60086624 missense probably damaging 1.00
R1836:Atp8a2 UTSW 14 60006366 missense possibly damaging 0.49
R1935:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1936:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1937:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R2416:Atp8a2 UTSW 14 59925008 missense probably damaging 1.00
R2760:Atp8a2 UTSW 14 59860192 missense probably benign 0.43
R3621:Atp8a2 UTSW 14 60026138 splice site probably null
R3768:Atp8a2 UTSW 14 60044336 missense probably benign 0.19
R3784:Atp8a2 UTSW 14 59773966 missense probably damaging 1.00
R3896:Atp8a2 UTSW 14 60026140 critical splice donor site probably null
R4009:Atp8a2 UTSW 14 60027985 missense possibly damaging 0.54
R4591:Atp8a2 UTSW 14 59654629 missense probably benign 0.03
R4866:Atp8a2 UTSW 14 59691467 missense probably damaging 1.00
R4879:Atp8a2 UTSW 14 60008469 nonsense probably null
R5059:Atp8a2 UTSW 14 59691537 missense probably benign 0.00
R5529:Atp8a2 UTSW 14 59793865 critical splice donor site probably null
R5788:Atp8a2 UTSW 14 60020793 missense probably damaging 0.96
R6126:Atp8a2 UTSW 14 60044326 missense probably benign
R6295:Atp8a2 UTSW 14 60012399 nonsense probably null
R6393:Atp8a2 UTSW 14 59773755 nonsense probably null
R6454:Atp8a2 UTSW 14 60008499 splice site probably null
R6651:Atp8a2 UTSW 14 59774021 missense probably benign 0.00
R6763:Atp8a2 UTSW 14 60008408 missense probably benign 0.12
R6767:Atp8a2 UTSW 14 60046722 missense probably damaging 1.00
R6912:Atp8a2 UTSW 14 60012410 missense probably benign 0.33
R7032:Atp8a2 UTSW 14 60017840 splice site probably null
R7243:Atp8a2 UTSW 14 59647842 missense probably benign
R7352:Atp8a2 UTSW 14 59791204 missense probably benign
R7355:Atp8a2 UTSW 14 60045004 missense possibly damaging 0.65
R7382:Atp8a2 UTSW 14 59654594 missense probably benign 0.00
R7451:Atp8a2 UTSW 14 59791181 missense probably null 0.00
R7483:Atp8a2 UTSW 14 60008375 missense probably benign 0.00
R7516:Atp8a2 UTSW 14 59857067 missense probably damaging 1.00
R7831:Atp8a2 UTSW 14 59773753 missense probably damaging 0.99
R8116:Atp8a2 UTSW 14 60026208 missense probably damaging 1.00
R8171:Atp8a2 UTSW 14 60046044 missense probably damaging 1.00
R8504:Atp8a2 UTSW 14 59647917 nonsense probably null
R8516:Atp8a2 UTSW 14 59691472 missense probably benign 0.00
R8552:Atp8a2 UTSW 14 59773982 missense probably benign 0.00
Z1088:Atp8a2 UTSW 14 60027970 missense probably benign
Z1177:Atp8a2 UTSW 14 60006330 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAGACTGCCCCTGTCGAATG -3'
(R):5'- TTCCACGTTGCAGGATGCTC -3'

Sequencing Primer
(F):5'- GAATGTCATGTGACCTCTGCTCAG -3'
(R):5'- GGATGCTCCACCTTGATTAAAC -3'
Posted On2015-02-05