Incidental Mutation 'R3029:H2-M11'
ID265919
Institutional Source Beutler Lab
Gene Symbol H2-M11
Ensembl Gene ENSMUSG00000037537
Gene Namehistocompatibility 2, M region locus 11
Synonyms
MMRRC Submission 040545-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3029 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location36547075-36549250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36548150 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 194 (T194I)
Ref Sequence ENSEMBL: ENSMUSP00000042522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041964]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041964
AA Change: T194I

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042522
Gene: ENSMUSG00000037537
AA Change: T194I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 2.8e-44 PFAM
IGc1 222 293 1.91e-18 SMART
transmembrane domain 308 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173968
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,718,245 I213T probably benign Het
Atp8a2 CGT CGTGT 14: 59,691,465 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk6 G A 5: 3,390,817 probably null Het
Cryab T A 9: 50,756,338 I124N probably damaging Het
E2f5 A G 3: 14,603,665 I206V probably benign Het
Eya4 T C 10: 23,123,878 T396A probably benign Het
Fat2 T C 11: 55,284,709 Y1726C probably damaging Het
Gad1 G A 2: 70,594,690 V443I probably benign Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Itgad T A 7: 128,178,371 I141N possibly damaging Het
Kcnh1 C T 1: 192,506,060 T970M probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp1a T A 11: 71,123,630 T265S probably damaging Het
Nsun4 A G 4: 116,052,725 S213P possibly damaging Het
Pkdrej C T 15: 85,817,004 R1577Q probably benign Het
Proz A T 8: 13,061,042 I5F probably benign Het
Rbm48 A T 5: 3,596,043 F54I possibly damaging Het
Rgs20 T C 1: 5,070,053 D42G probably benign Het
Rxfp2 A C 5: 150,043,130 D111A probably benign Het
Sparcl1 T C 5: 104,093,226 T111A possibly damaging Het
Vmn2r14 T A 5: 109,215,910 L713F probably damaging Het
Other mutations in H2-M11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:H2-M11 APN 17 36547553 missense probably benign 0.00
IGL01657:H2-M11 APN 17 36547573 missense probably benign 0.00
IGL02249:H2-M11 APN 17 36547937 missense probably benign 0.39
IGL03263:H2-M11 APN 17 36548913 missense probably damaging 1.00
R0481:H2-M11 UTSW 17 36548954 nonsense probably null
R0639:H2-M11 UTSW 17 36547391 missense probably benign 0.00
R0866:H2-M11 UTSW 17 36548937 missense probably benign 0.00
R0924:H2-M11 UTSW 17 36549214 missense probably benign
R0925:H2-M11 UTSW 17 36547461 missense probably benign 0.00
R1707:H2-M11 UTSW 17 36548766 missense probably damaging 1.00
R2212:H2-M11 UTSW 17 36548930 missense probably damaging 1.00
R2566:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R2567:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R3030:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R3893:H2-M11 UTSW 17 36547090 missense probably benign 0.01
R3946:H2-M11 UTSW 17 36549231 missense probably damaging 1.00
R4647:H2-M11 UTSW 17 36547991 missense probably benign 0.06
R4679:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R4868:H2-M11 UTSW 17 36548919 missense probably damaging 1.00
R4876:H2-M11 UTSW 17 36547509 missense probably benign 0.09
R5496:H2-M11 UTSW 17 36547979 missense possibly damaging 0.73
R6514:H2-M11 UTSW 17 36548947 missense probably damaging 1.00
R7779:H2-M11 UTSW 17 36548806 missense probably benign 0.14
R8072:H2-M11 UTSW 17 36548134 missense probably benign 0.13
R8210:H2-M11 UTSW 17 36547968 missense probably damaging 0.98
Z1176:H2-M11 UTSW 17 36548770 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCACACAATCCAGAGAAGGTATGG -3'
(R):5'- GAGAGTCCCTCCTTCATGTTG -3'

Sequencing Primer
(F):5'- CTGCCTCGAGGGTATTTCAGAAAC -3'
(R):5'- CCTTCATGTTGATTCAAGAAACCC -3'
Posted On2015-02-05