Incidental Mutation 'R1889:Dpp7'
ID 265990
Institutional Source Beutler Lab
Gene Symbol Dpp7
Ensembl Gene ENSMUSG00000026958
Gene Name dipeptidylpeptidase 7
Synonyms QPP
MMRRC Submission 039910-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R1889 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 25242302-25246365 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 25243691 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028332] [ENSMUST00000042390]
AlphaFold Q9ET22
Predicted Effect probably null
Transcript: ENSMUST00000028332
SMART Domains Protein: ENSMUSP00000028332
Gene: ENSMUSG00000026958

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Peptidase_S28 48 475 2.3e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042390
SMART Domains Protein: ENSMUSP00000036996
Gene: ENSMUSG00000036646

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 29 42 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
Pfam:Glyco_hydro_47 215 654 9.5e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144218
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes. The resting lymphocytes are maintained through suppression of apoptosis, a state which is disrupted by inhibition of this novel serine protease. The enzyme has strong sequence homology with prolylcarboxypeptidase and is active at both acidic and neutral pH. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,034,815 (GRCm39) noncoding transcript Het
9130008F23Rik T C 17: 41,191,193 (GRCm39) R79G probably damaging Het
Aco1 A T 4: 40,164,607 (GRCm39) probably null Het
Acp6 C T 3: 97,073,201 (GRCm39) R81W probably damaging Het
Agbl1 A C 7: 76,239,129 (GRCm39) Y543S probably damaging Het
Anapc7 T C 5: 122,571,539 (GRCm39) W205R probably damaging Het
Ap1g2 T A 14: 55,338,886 (GRCm39) M532L probably damaging Het
Appl1 A G 14: 26,647,470 (GRCm39) probably benign Het
Arhgef19 T C 4: 140,976,624 (GRCm39) F462S probably damaging Het
Astn1 A G 1: 158,332,886 (GRCm39) probably null Het
AU015836 T C X: 93,012,985 (GRCm39) probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Cadm2 T C 16: 66,679,683 (GRCm39) D50G probably damaging Het
Ccdc81 G A 7: 89,531,502 (GRCm39) Q324* probably null Het
Cd300lf A G 11: 115,011,206 (GRCm39) V178A probably benign Het
Cdt1 T C 8: 123,298,791 (GRCm39) V476A possibly damaging Het
Cenpj A G 14: 56,796,182 (GRCm39) V225A probably benign Het
Cep295 T C 9: 15,243,399 (GRCm39) T1686A possibly damaging Het
Cfap54 A G 10: 92,870,572 (GRCm39) S684P possibly damaging Het
Clip1 C A 5: 123,791,559 (GRCm39) V204F probably damaging Het
Cnpy4 A G 5: 138,191,102 (GRCm39) E226G probably benign Het
Col6a3 T A 1: 90,731,433 (GRCm39) M1000L probably benign Het
Cpsf1 T C 15: 76,486,356 (GRCm39) M335V probably benign Het
Dnmt3b C A 2: 153,518,679 (GRCm39) A614E probably benign Het
Dpm1 C T 2: 168,059,655 (GRCm39) R147Q possibly damaging Het
Engase T C 11: 118,369,759 (GRCm39) F57S probably damaging Het
Epb41l5 T C 1: 119,476,902 (GRCm39) D718G possibly damaging Het
Fam20a T C 11: 109,564,380 (GRCm39) K458E probably benign Het
Fbxo44 C G 4: 148,240,726 (GRCm39) R220S probably damaging Het
Gkn2 T A 6: 87,355,137 (GRCm39) Y115* probably null Het
Gtdc1 A G 2: 44,481,926 (GRCm39) S246P probably damaging Het
H2-Q2 A G 17: 35,564,152 (GRCm39) D302G probably benign Het
Herc2 C T 7: 55,839,561 (GRCm39) S3357L possibly damaging Het
Herc6 T A 6: 57,639,060 (GRCm39) Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,211,472 (GRCm39) probably benign Het
Ift122 T C 6: 115,871,382 (GRCm39) probably null Het
Ilf3 T A 9: 21,316,063 (GRCm39) probably benign Het
Itgb2 A T 10: 77,384,457 (GRCm39) N193Y possibly damaging Het
Itgb5 T G 16: 33,730,839 (GRCm39) I65S probably damaging Het
Jpt2 T C 17: 25,179,585 (GRCm39) M1V probably null Het
Kcnt2 A T 1: 140,512,031 (GRCm39) H995L probably damaging Het
Kif20b T C 19: 34,918,608 (GRCm39) probably benign Het
Kif7 T C 7: 79,360,211 (GRCm39) Y342C probably damaging Het
Klhl21 T C 4: 152,099,877 (GRCm39) V529A possibly damaging Het
Klhl26 T C 8: 70,904,383 (GRCm39) D475G probably damaging Het
Lcor T C 19: 41,547,567 (GRCm39) Y384H probably damaging Het
Lrp1b A T 2: 40,809,179 (GRCm39) C2463* probably null Het
Marchf6 T C 15: 31,459,339 (GRCm39) E909G possibly damaging Het
Mrc1 A T 2: 14,313,488 (GRCm39) probably null Het
Mtrex T C 13: 113,024,024 (GRCm39) N707S probably benign Het
Nipal4 T A 11: 46,041,560 (GRCm39) I212F probably damaging Het
Nup98 T A 7: 101,809,923 (GRCm39) T536S probably damaging Het
Nwd2 A G 5: 63,965,009 (GRCm39) E1531G possibly damaging Het
Nxpe2 T C 9: 48,237,914 (GRCm39) T114A probably damaging Het
Oosp1 C T 19: 11,645,158 (GRCm39) V169I possibly damaging Het
Opa1 T C 16: 29,444,403 (GRCm39) V863A possibly damaging Het
Or5ac22 T G 16: 59,135,326 (GRCm39) Y148S probably damaging Het
Pabpc4l A T 3: 46,400,798 (GRCm39) M282K probably benign Het
Parp14 G A 16: 35,677,130 (GRCm39) A946V probably benign Het
Pcnx3 T C 19: 5,722,684 (GRCm39) D1336G probably damaging Het
Phlpp1 T C 1: 106,246,580 (GRCm39) V590A possibly damaging Het
Rbck1 T A 2: 152,160,276 (GRCm39) T468S probably damaging Het
Ripor2 T A 13: 24,877,870 (GRCm39) I290N probably damaging Het
Rnf139 T C 15: 58,771,346 (GRCm39) L457P probably damaging Het
Rtn1 C A 12: 72,351,184 (GRCm39) A342S possibly damaging Het
Sema3d A G 5: 12,534,988 (GRCm39) probably null Het
Serpinb2 T A 1: 107,452,337 (GRCm39) V305D probably damaging Het
Sez6l2 T C 7: 126,552,668 (GRCm39) V148A probably damaging Het
Shank2 C A 7: 143,740,595 (GRCm39) S568* probably null Het
Slc10a4 T C 5: 73,169,490 (GRCm39) S372P possibly damaging Het
Slc10a5 T C 3: 10,400,550 (GRCm39) T37A probably benign Het
Slc14a1 T C 18: 78,152,912 (GRCm39) I276V possibly damaging Het
Slc6a20b G T 9: 123,461,269 (GRCm39) D52E probably benign Het
Slc6a5 T C 7: 49,601,182 (GRCm39) M661T probably benign Het
Ssh2 C G 11: 77,340,571 (GRCm39) D574E probably damaging Het
Steap4 G T 5: 8,025,892 (GRCm39) R151L probably damaging Het
Sun5 T A 2: 153,707,915 (GRCm39) I107L probably benign Het
Tacc1 C T 8: 25,665,269 (GRCm39) V488M probably damaging Het
Tgs1 A G 4: 3,614,928 (GRCm39) T829A probably benign Het
Tnxb A G 17: 34,914,799 (GRCm39) E1929G probably damaging Het
Tssc4 A C 7: 142,624,292 (GRCm39) Q200P probably damaging Het
Ttn A G 2: 76,588,876 (GRCm39) W21398R probably damaging Het
Usp50 C T 2: 126,619,818 (GRCm39) probably null Het
Usp9y A T Y: 1,448,829 (GRCm39) probably null Het
V1rd19 T A 7: 23,702,632 (GRCm39) F33I probably benign Het
Zfat T C 15: 67,973,388 (GRCm39) T1118A probably benign Het
Other mutations in Dpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Dpp7 APN 2 25,244,625 (GRCm39) missense probably benign 0.01
IGL02897:Dpp7 APN 2 25,243,684 (GRCm39) missense probably damaging 1.00
IGL02992:Dpp7 APN 2 25,244,589 (GRCm39) missense possibly damaging 0.65
IGL03069:Dpp7 APN 2 25,245,735 (GRCm39) critical splice acceptor site probably null
1mM(1):Dpp7 UTSW 2 25,246,152 (GRCm39) missense probably benign 0.05
PIT4519001:Dpp7 UTSW 2 25,242,460 (GRCm39) missense probably damaging 0.97
R0051:Dpp7 UTSW 2 25,246,107 (GRCm39) missense possibly damaging 0.80
R0051:Dpp7 UTSW 2 25,246,107 (GRCm39) missense possibly damaging 0.80
R0900:Dpp7 UTSW 2 25,246,311 (GRCm39) missense probably damaging 0.99
R1895:Dpp7 UTSW 2 25,243,691 (GRCm39) splice site probably null
R2055:Dpp7 UTSW 2 25,244,490 (GRCm39) missense possibly damaging 0.84
R4697:Dpp7 UTSW 2 25,244,931 (GRCm39) missense probably benign 0.00
R4832:Dpp7 UTSW 2 25,242,398 (GRCm39) unclassified probably benign
R4887:Dpp7 UTSW 2 25,242,770 (GRCm39) critical splice acceptor site probably null
R5114:Dpp7 UTSW 2 25,242,749 (GRCm39) missense possibly damaging 0.51
R6976:Dpp7 UTSW 2 25,244,836 (GRCm39) critical splice acceptor site probably null
R7577:Dpp7 UTSW 2 25,245,603 (GRCm39) missense probably benign
R8459:Dpp7 UTSW 2 25,242,550 (GRCm39) missense probably damaging 1.00
R8486:Dpp7 UTSW 2 25,242,561 (GRCm39) missense probably damaging 1.00
R8672:Dpp7 UTSW 2 25,246,133 (GRCm39) missense probably benign 0.00
R8690:Dpp7 UTSW 2 25,245,645 (GRCm39) missense probably damaging 1.00
X0058:Dpp7 UTSW 2 25,244,764 (GRCm39) missense probably benign 0.05
Predicted Primers
Posted On 2015-02-05