Incidental Mutation 'R1981:Casp8'
ID266029
Institutional Source Beutler Lab
Gene Symbol Casp8
Ensembl Gene ENSMUSG00000026029
Gene Namecaspase 8
SynonymsMACH, Mch5, FLICE, Caspase-8
MMRRC Submission 039993-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1981 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58795374-58847503 bp(+) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) C to A at 58828962 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027189] [ENSMUST00000165549] [ENSMUST00000190213] [ENSMUST00000191201]
Predicted Effect probably null
Transcript: ENSMUST00000027189
SMART Domains Protein: ENSMUSP00000027189
Gene: ENSMUSG00000026029

DomainStartEndE-ValueType
DED 1 80 3.21e-23 SMART
DED 99 178 1.01e-15 SMART
CASc 227 480 2.13e-110 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165549
SMART Domains Protein: ENSMUSP00000127375
Gene: ENSMUSG00000026029

DomainStartEndE-ValueType
DED 1 80 3.21e-23 SMART
DED 99 178 1.01e-15 SMART
CASc 227 480 2.13e-110 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190213
SMART Domains Protein: ENSMUSP00000140335
Gene: ENSMUSG00000026029

DomainStartEndE-ValueType
DED 21 100 1.5e-25 SMART
DED 119 198 5e-18 SMART
CASc 247 500 1.1e-112 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191201
SMART Domains Protein: ENSMUSP00000140546
Gene: ENSMUSG00000026029

DomainStartEndE-ValueType
DED 21 100 1.5e-25 SMART
DED 119 198 5e-18 SMART
CASc 247 500 1.1e-112 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: This gene is part of a family of caspases, aspartate-specific cysteine proteases well studied for their involvement in immune and apoptosis signaling. This protein, an initiator of apoptotic cell death, is activated by death-inducing tumor necrosis family receptors and targets downstream effectors. In mouse deficiency of this gene can cause embryonic lethality. This protein may have a role in embryogenesis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired cardiac muscle development, cardiac erythrocyte congestion, low numbers of colony-forming cells, and prenatal lethality. T-cell restricted knockout mice are viable, but immunodeficient. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atad1 G T 19: 32,695,810 D224E probably benign Het
Atp1a3 T G 7: 25,000,975 E33A probably benign Het
Baz2b A G 2: 59,923,680 F1100L possibly damaging Het
Car7 C T 8: 104,548,377 probably benign Het
Cdh23 A T 10: 60,378,751 L1495H probably damaging Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Col16a1 C G 4: 130,065,443 P346A unknown Het
Cyp2c29 A G 19: 39,307,772 probably null Het
Cyp3a13 T C 5: 137,911,856 S139G probably damaging Het
Dapk2 A G 9: 66,268,898 H327R probably benign Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dnah2 A G 11: 69,474,325 Y1944H probably damaging Het
Dnaic2 T A 11: 114,732,929 V6E probably damaging Het
Eipr1 T C 12: 28,863,025 Y242H probably damaging Het
Fam149a T G 8: 45,381,741 D7A probably damaging Het
Fam217a T A 13: 34,916,754 D140V probably benign Het
Fat4 G A 3: 38,991,664 C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Gcsam A T 16: 45,619,974 T127S probably damaging Het
Git2 C T 5: 114,749,559 probably benign Het
Gm1527 T C 3: 28,915,835 probably null Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gtf3c1 A G 7: 125,644,272 L1720P possibly damaging Het
Hat1 A G 2: 71,389,977 T28A probably benign Het
Igf2r G A 17: 12,733,903 Q219* probably null Het
Impdh1 T A 6: 29,206,451 D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Ltbp3 A G 19: 5,758,079 Q1250R probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mast2 T C 4: 116,314,840 Y569C probably damaging Het
Mcoln3 A T 3: 146,140,590 K552* probably null Het
Mctp2 T C 7: 72,164,698 Q601R probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Myo19 A T 11: 84,892,170 Q170L possibly damaging Het
Myo1h T C 5: 114,353,837 F676S probably damaging Het
Myo9a A G 9: 59,894,146 T1876A probably benign Het
Nav3 G T 10: 109,719,090 probably benign Het
Ndor1 T C 2: 25,255,224 Y43C probably damaging Het
Nlrp1a A G 11: 71,098,938 V1102A probably damaging Het
Nmnat3 T C 9: 98,410,299 I199T possibly damaging Het
Nsun7 T C 5: 66,261,214 S96P probably damaging Het
Ntng1 A G 3: 109,935,010 V149A possibly damaging Het
Oas3 T C 5: 120,761,835 probably benign Het
Olfr1055 A T 2: 86,347,142 I208N possibly damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr1350 A G 7: 6,570,558 D189G probably benign Het
Olfr1418 T G 19: 11,855,007 Q315H possibly damaging Het
Olfr147 T C 9: 38,403,735 L287P probably damaging Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Pax2 G A 19: 44,818,465 D301N probably damaging Het
Pcsk4 T A 10: 80,325,779 E176V probably damaging Het
Pkhd1 G A 1: 20,117,060 P3675S probably benign Het
Plekho2 A T 9: 65,558,692 L138Q probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr11 T A 11: 87,103,290 D100V probably damaging Het
Qars A G 9: 108,515,028 N136D probably damaging Het
Rbm15b A G 9: 106,881,623 probably benign Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rsrc1 A G 3: 67,350,005 D250G probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Scn2a C A 2: 65,690,170 N503K probably damaging Het
Sh2d6 G A 6: 72,517,544 probably benign Het
Smg8 T C 11: 87,085,331 T475A probably benign Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Tbx20 T A 9: 24,770,913 K48N possibly damaging Het
Tead1 C A 7: 112,891,745 D231E probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tjp1 A T 7: 65,312,855 F1111L probably damaging Het
Tlr11 T A 14: 50,361,988 I477K possibly damaging Het
Ttc13 A G 8: 124,714,187 probably null Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Usp15 T A 10: 123,125,041 probably benign Het
Usp18 A G 6: 121,252,517 K32E probably benign Het
Vmn1r12 A T 6: 57,159,661 M248L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp930 T A 8: 69,228,172 L172H probably damaging Het
Zfp976 G A 7: 42,613,622 H264Y probably damaging Het
Other mutations in Casp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Casp8 APN 1 58827314 critical splice donor site probably null
IGL00825:Casp8 APN 1 58829006 missense probably benign 0.02
IGL02025:Casp8 APN 1 58824147 missense possibly damaging 0.81
IGL02549:Casp8 APN 1 58833766 missense probably benign
amontillado UTSW 1 58844770 missense probably damaging 1.00
Porto UTSW 1 58833698 missense possibly damaging 0.89
IGL02991:Casp8 UTSW 1 58827279 missense probably benign 0.00
R0609:Casp8 UTSW 1 58844792 missense probably benign 0.00
R0960:Casp8 UTSW 1 58829013 critical splice donor site probably null
R1433:Casp8 UTSW 1 58824124 missense probably damaging 1.00
R1505:Casp8 UTSW 1 58828922 missense probably damaging 0.99
R1506:Casp8 UTSW 1 58824196 missense probably damaging 0.97
R1596:Casp8 UTSW 1 58831674 splice site probably benign
R1674:Casp8 UTSW 1 58844416 missense probably damaging 1.00
R1676:Casp8 UTSW 1 58844416 missense probably damaging 1.00
R3909:Casp8 UTSW 1 58844811 missense probably damaging 1.00
R3911:Casp8 UTSW 1 58833705 missense probably damaging 1.00
R4231:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4233:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4234:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4235:Casp8 UTSW 1 58833698 missense possibly damaging 0.89
R4236:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4917:Casp8 UTSW 1 58827218 missense probably damaging 1.00
R4918:Casp8 UTSW 1 58827218 missense probably damaging 1.00
R5063:Casp8 UTSW 1 58844374 missense probably damaging 1.00
R5092:Casp8 UTSW 1 58844676 missense possibly damaging 0.53
R5153:Casp8 UTSW 1 58844845 missense probably benign 0.00
R5964:Casp8 UTSW 1 58833736 missense possibly damaging 0.62
R5979:Casp8 UTSW 1 58828912 missense probably benign
R7602:Casp8 UTSW 1 58833739 missense probably benign 0.43
R7675:Casp8 UTSW 1 58823947 missense possibly damaging 0.69
Predicted Primers
Posted On2015-02-05