Incidental Mutation 'R2914:Pigb'
ID266192
Institutional Source Beutler Lab
Gene Symbol Pigb
Ensembl Gene ENSMUSG00000079469
Gene Namephosphatidylinositol glycan anchor biosynthesis, class B
Synonyms
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R2914 (G1)
Quality Score99
Status Not validated
Chromosome9
Chromosomal Location73007419-73040378 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 73039778 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098566] [ENSMUST00000183746] [ENSMUST00000184035] [ENSMUST00000184389]
Predicted Effect probably null
Transcript: ENSMUST00000098566
SMART Domains Protein: ENSMUSP00000096165
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 4.7e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183746
SMART Domains Protein: ENSMUSP00000138885
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183904
Predicted Effect probably null
Transcript: ENSMUST00000184035
SMART Domains Protein: ENSMUSP00000139269
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184319
Predicted Effect probably null
Transcript: ENSMUST00000184389
SMART Domains Protein: ENSMUSP00000139076
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is located in the endoplasmic reticulum and is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene is thought to encode a member of a family of dolichol-phosphate-mannose (Dol-P-Man) dependent mannosyltransferases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Pigb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Pigb APN 9 73022291 missense probably damaging 0.98
IGL01792:Pigb APN 9 73017986 missense probably damaging 1.00
IGL02416:Pigb APN 9 73017432 missense probably benign 0.00
R2396:Pigb UTSW 9 73015271 nonsense probably null
R3830:Pigb UTSW 9 73017473 missense probably benign 0.03
R5048:Pigb UTSW 9 73029708 critical splice acceptor site probably null
R5158:Pigb UTSW 9 73022401 missense probably damaging 1.00
R5180:Pigb UTSW 9 73034590 missense probably damaging 0.99
R5385:Pigb UTSW 9 73039545 missense probably benign 0.05
R5866:Pigb UTSW 9 73029684 missense probably damaging 1.00
R7460:Pigb UTSW 9 73038675 missense probably damaging 0.99
R7552:Pigb UTSW 9 73034488 missense probably benign 0.30
R8005:Pigb UTSW 9 73015264 missense unknown
R8136:Pigb UTSW 9 73022320 missense possibly damaging 0.77
Z1176:Pigb UTSW 9 73034572 missense probably benign
Predicted Primers
Posted On2015-02-05