Incidental Mutation 'R3432:Actr3'
ID266221
Institutional Source Beutler Lab
Gene Symbol Actr3
Ensembl Gene ENSMUSG00000026341
Gene NameARP3 actin-related protein 3
Synonyms1200003A09Rik, Arp3
MMRRC Submission 040650-MU
Accession Numbers

Ncbi RefSeq: NM_023735.2, NM_001205385.1, NM_001205386.1; MGI: 1921367

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3432 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location125392905-125435727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125394039 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 405 (P405S)
Ref Sequence ENSEMBL: ENSMUSP00000137503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027579] [ENSMUST00000178474] [ENSMUST00000191578]
Predicted Effect probably damaging
Transcript: ENSMUST00000027579
AA Change: P405S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027579
Gene: ENSMUSG00000026341
AA Change: P405S

DomainStartEndE-ValueType
ACTIN 5 413 1.62e-186 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178474
AA Change: P405S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137503
Gene: ENSMUSG00000026341
AA Change: P405S

DomainStartEndE-ValueType
ACTIN 5 413 1.62e-186 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188362
Predicted Effect probably benign
Transcript: ENSMUST00000191578
Meta Mutation Damage Score 0.2455 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype Strain: 3765916
Lethality: E3-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele die prior to E4.5 and exhibit abnormal embryogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(12)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Arsj A T 3: 126,364,975 T68S probably benign Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Dhrs7c C T 11: 67,809,873 T82I probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fam89b A T 19: 5,731,733 probably null Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Gstp1 G A 19: 4,036,695 T110I possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Olfr983 A T 9: 40,092,549 M139K probably damaging Het
Psg18 A G 7: 18,349,171 V232A possibly damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rbm15 A T 3: 107,330,677 S802T probably benign Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Serpinb1a T C 13: 32,842,859 T367A possibly damaging Het
Sirpb1a A G 3: 15,426,387 W7R probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Zfp872 C T 9: 22,200,454 R410* probably null Het
Other mutations in Actr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Actr3 APN 1 125397229 missense probably benign 0.00
IGL00574:Actr3 APN 1 125411274 missense probably damaging 1.00
IGL00715:Actr3 APN 1 125395076 missense probably damaging 0.96
IGL01139:Actr3 APN 1 125405885 missense probably damaging 1.00
IGL01897:Actr3 APN 1 125418288 missense possibly damaging 0.54
P0023:Actr3 UTSW 1 125395066 critical splice donor site probably null
R0217:Actr3 UTSW 1 125407413 splice site probably benign
R0660:Actr3 UTSW 1 125408567 missense probably benign 0.40
R1494:Actr3 UTSW 1 125416281 missense probably benign 0.06
R1582:Actr3 UTSW 1 125405925 missense probably benign 0.01
R1589:Actr3 UTSW 1 125408563 missense probably damaging 1.00
R5810:Actr3 UTSW 1 125416379 intron probably benign
R6089:Actr3 UTSW 1 125407395 missense probably damaging 1.00
R6276:Actr3 UTSW 1 125395137 missense probably benign
R7120:Actr3 UTSW 1 125403432 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAAACAATCGTCTTAGCTCTC -3'
(R):5'- TCCAAAAGCCATGAATCGACTG -3'

Sequencing Primer
(F):5'- ACATCTGCATGTTGACACACTC -3'
(R):5'- CCTCTCAAATGCATTGTTCT -3'
Posted On2015-02-18