Incidental Mutation 'R3432:Bahd1'
ID266223
Institutional Source Beutler Lab
Gene Symbol Bahd1
Ensembl Gene ENSMUSG00000040007
Gene Namebromo adjacent homology domain containing 1
SynonymsLOC228536
MMRRC Submission 040650-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3432 (G1)
Quality Score214
Status Validated
Chromosome2
Chromosomal Location118900377-118924528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118922523 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 757 (R757H)
Ref Sequence ENSEMBL: ENSMUSP00000043130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036578] [ENSMUST00000099546] [ENSMUST00000110837]
Predicted Effect probably damaging
Transcript: ENSMUST00000036578
AA Change: R757H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043130
Gene: ENSMUSG00000040007
AA Change: R757H

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 117 141 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 564 579 N/A INTRINSIC
BAH 616 771 1.17e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099546
SMART Domains Protein: ENSMUSP00000099579
Gene: ENSMUSG00000074916

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:Sulfotransfer_2 139 365 1.6e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110837
SMART Domains Protein: ENSMUSP00000106461
Gene: ENSMUSG00000074916

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:Sulfotransfer_2 135 340 1.5e-41 PFAM
Meta Mutation Damage Score 0.8159 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,394,039 P405S probably damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Arsj A T 3: 126,364,975 T68S probably benign Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Dhrs7c C T 11: 67,809,873 T82I probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fam89b A T 19: 5,731,733 probably null Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Gstp1 G A 19: 4,036,695 T110I possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Olfr983 A T 9: 40,092,549 M139K probably damaging Het
Psg18 A G 7: 18,349,171 V232A possibly damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rbm15 A T 3: 107,330,677 S802T probably benign Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Serpinb1a T C 13: 32,842,859 T367A possibly damaging Het
Sirpb1a A G 3: 15,426,387 W7R probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Zfp872 C T 9: 22,200,454 R410* probably null Het
Other mutations in Bahd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Bahd1 APN 2 118917205 missense probably benign 0.01
IGL02425:Bahd1 APN 2 118919164 missense probably benign 0.00
IGL02548:Bahd1 APN 2 118917045 missense possibly damaging 0.79
IGL03024:Bahd1 APN 2 118916116 missense probably damaging 1.00
R0932:Bahd1 UTSW 2 118915927 missense probably damaging 1.00
R1737:Bahd1 UTSW 2 118915923 missense probably damaging 1.00
R2845:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2846:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2899:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2900:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2966:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2985:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2986:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3017:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3018:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3019:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3020:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3021:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3033:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3040:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3431:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3617:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4319:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4394:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4395:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4418:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4456:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4462:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4484:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R5537:Bahd1 UTSW 2 118915980 missense probably damaging 0.96
R5556:Bahd1 UTSW 2 118916270 missense probably damaging 1.00
R6490:Bahd1 UTSW 2 118917138 missense probably benign 0.01
R6736:Bahd1 UTSW 2 118915975 missense possibly damaging 0.54
R7604:Bahd1 UTSW 2 118916310 missense probably benign
Z1176:Bahd1 UTSW 2 118922403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCCAGCTCAGTGTTAGG -3'
(R):5'- GCTGAGGGTCTAGATACCTTTC -3'

Sequencing Primer
(F):5'- GGAAGAAATTGGTTTCCTTGAAAGC -3'
(R):5'- GAGGGTCTAGATACCTTTCTCATATC -3'
Posted On2015-02-18