Incidental Mutation 'R3432:Sirpb1a'
ID266225
Institutional Source Beutler Lab
Gene Symbol Sirpb1a
Ensembl Gene ENSMUSG00000095788
Gene Namesignal-regulatory protein beta 1A
Synonyms9930027N05Rik, Sirpb1
MMRRC Submission 040650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3432 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location15371653-15426520 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15426387 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 7 (W7R)
Ref Sequence ENSEMBL: ENSMUSP00000141504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099201] [ENSMUST00000192700] [ENSMUST00000194144]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099201
AA Change: W7R

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096807
Gene: ENSMUSG00000095788
AA Change: W7R

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191958
Predicted Effect probably damaging
Transcript: ENSMUST00000192700
AA Change: W7R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141504
Gene: ENSMUSG00000095788
AA Change: W7R

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194144
AA Change: W7R
SMART Domains Protein: ENSMUSP00000141659
Gene: ENSMUSG00000095788
AA Change: W7R

DomainStartEndE-ValueType
Pfam:Ig_2 15 66 6.6e-1 PFAM
Pfam:Ig_3 21 52 1.7e-2 PFAM
Pfam:V-set 23 75 1.2e-7 PFAM
IGc1 96 169 4.8e-7 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,394,039 P405S probably damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Arsj A T 3: 126,364,975 T68S probably benign Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Dhrs7c C T 11: 67,809,873 T82I probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fam89b A T 19: 5,731,733 probably null Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Gstp1 G A 19: 4,036,695 T110I possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Olfr983 A T 9: 40,092,549 M139K probably damaging Het
Psg18 A G 7: 18,349,171 V232A possibly damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rbm15 A T 3: 107,330,677 S802T probably benign Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Serpinb1a T C 13: 32,842,859 T367A possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Zfp872 C T 9: 22,200,454 R410* probably null Het
Other mutations in Sirpb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Sirpb1a APN 3 15410728 unclassified probably benign
IGL00597:Sirpb1a APN 3 15416917 missense probably damaging 1.00
IGL01521:Sirpb1a APN 3 15410501 missense probably benign 0.00
IGL01678:Sirpb1a APN 3 15411310 missense probably damaging 1.00
IGL02154:Sirpb1a APN 3 15410444 missense probably damaging 1.00
IGL02275:Sirpb1a APN 3 15410409 critical splice donor site probably null
IGL02419:Sirpb1a APN 3 15426338 missense probably benign
IGL02657:Sirpb1a APN 3 15417051 missense possibly damaging 0.85
IGL03086:Sirpb1a APN 3 15426328 splice site probably null
PIT4142001:Sirpb1a UTSW 3 15411198 missense probably benign 0.00
R0270:Sirpb1a UTSW 3 15410527 missense probably damaging 1.00
R1975:Sirpb1a UTSW 3 15379081 missense probably benign 0.00
R4613:Sirpb1a UTSW 3 15417037 missense probably benign 0.09
R5325:Sirpb1a UTSW 3 15411443 missense possibly damaging 0.90
R6223:Sirpb1a UTSW 3 15379026 missense probably benign 0.02
R6526:Sirpb1a UTSW 3 15379020 missense probably damaging 0.99
R6903:Sirpb1a UTSW 3 15416924 missense probably damaging 0.99
R7349:Sirpb1a UTSW 3 15410604 missense probably damaging 0.99
R7513:Sirpb1a UTSW 3 15411443 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCAGTGCTCAAAATTCTGGCTC -3'
(R):5'- TCCCTGAAGCTGAATGCAAC -3'

Sequencing Primer
(F):5'- TACCTCTCCTGTGACAGT -3'
(R):5'- GCTGAATGCAACACTGTTTAGC -3'
Posted On2015-02-18