Incidental Mutation 'R3432:Rbm15'
ID266226
Institutional Source Beutler Lab
Gene Symbol Rbm15
Ensembl Gene ENSMUSG00000048109
Gene NameRNA binding motif protein 15
Synonyms
MMRRC Submission 040650-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3432 (G1)
Quality Score220
Status Validated
Chromosome3
Chromosomal Location107325421-107333673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107330677 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 802 (S802T)
Ref Sequence ENSEMBL: ENSMUSP00000054424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061772]
Predicted Effect probably benign
Transcript: ENSMUST00000061772
AA Change: S802T

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054424
Gene: ENSMUSG00000048109
AA Change: S802T

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 56 96 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
low complexity region 133 163 N/A INTRINSIC
RRM 170 247 7.49e-5 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
RRM 374 446 1.33e-10 SMART
RRM 455 524 2.51e-6 SMART
low complexity region 532 542 N/A INTRINSIC
low complexity region 564 582 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
internal_repeat_2 613 685 7.13e-5 PROSPERO
internal_repeat_2 677 753 7.13e-5 PROSPERO
low complexity region 754 771 N/A INTRINSIC
Pfam:SPOC 789 925 1.7e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197769
Meta Mutation Damage Score 0.0700 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SPEN (Split-end) family of proteins, including RBM15, have repressor function in several signaling pathways and may bind to RNA through interaction with spliceosome components (Hiriart et al., 2005 [PubMed 16129689]).[supplied by OMIM, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality around E9.5. Mice homozygous for a floxed allele activate in hematopoietic cells exhibit increased megakaryocyte cell number, long-term hematopoietic stem cells, and red pulp as well as decreased B cells and leukocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,394,039 P405S probably damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Arsj A T 3: 126,364,975 T68S probably benign Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Dhrs7c C T 11: 67,809,873 T82I probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fam89b A T 19: 5,731,733 probably null Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Gstp1 G A 19: 4,036,695 T110I possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Olfr983 A T 9: 40,092,549 M139K probably damaging Het
Psg18 A G 7: 18,349,171 V232A possibly damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Serpinb1a T C 13: 32,842,859 T367A possibly damaging Het
Sirpb1a A G 3: 15,426,387 W7R probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Zfp872 C T 9: 22,200,454 R410* probably null Het
Other mutations in Rbm15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Rbm15 APN 3 107331010 missense probably damaging 0.98
IGL01933:Rbm15 APN 3 107331103 missense probably damaging 0.99
IGL02116:Rbm15 APN 3 107330280 missense probably damaging 1.00
IGL02886:Rbm15 APN 3 107326295 missense probably benign 0.41
R0281:Rbm15 UTSW 3 107331155 missense probably damaging 0.99
R0374:Rbm15 UTSW 3 107330564 missense probably damaging 1.00
R0376:Rbm15 UTSW 3 107330938 missense probably benign 0.00
R0501:Rbm15 UTSW 3 107332530 missense possibly damaging 0.91
R0517:Rbm15 UTSW 3 107331369 missense probably damaging 1.00
R1347:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1347:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1348:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1372:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1373:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1377:Rbm15 UTSW 3 107330758 missense probably benign
R1616:Rbm15 UTSW 3 107330881 missense probably benign
R1708:Rbm15 UTSW 3 107331220 missense probably damaging 1.00
R1944:Rbm15 UTSW 3 107331552 missense probably damaging 1.00
R2519:Rbm15 UTSW 3 107330833 missense probably benign 0.08
R4885:Rbm15 UTSW 3 107332254 missense probably benign 0.25
R5434:Rbm15 UTSW 3 107330467 missense possibly damaging 0.70
R6915:Rbm15 UTSW 3 107332311 missense probably benign 0.07
R7336:Rbm15 UTSW 3 107333116 start gained probably benign
R7799:Rbm15 UTSW 3 107332143 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCAGGTACAGCCAGGAGAATG -3'
(R):5'- TAGGAAGCATCGGACAGCTG -3'

Sequencing Primer
(F):5'- ATCTTGAGTTGGGCCACT -3'
(R):5'- GACAGCTGCTCCCACAGAG -3'
Posted On2015-02-18