Incidental Mutation 'R3432:Mcm2'
ID 266233
Institutional Source Beutler Lab
Gene Symbol Mcm2
Ensembl Gene ENSMUSG00000002870
Gene Name minichromosome maintenance complex component 2
Synonyms BM28, CDCL1, Mcmd2
MMRRC Submission 040650-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3432 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 88860456-88875762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 88869990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 60 (R60C)
Ref Sequence ENSEMBL: ENSMUSP00000145295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058011] [ENSMUST00000205165]
AlphaFold P97310
Predicted Effect possibly damaging
Transcript: ENSMUST00000058011
AA Change: R204C

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061923
Gene: ENSMUSG00000002870
AA Change: R204C

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:MCM2_N 50 182 3.5e-20 PFAM
MCM 290 803 N/A SMART
Blast:MCM 816 891 3e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203172
Predicted Effect probably benign
Transcript: ENSMUST00000203935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204393
Predicted Effect probably damaging
Transcript: ENSMUST00000205165
AA Change: R60C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145295
Gene: ENSMUSG00000002870
AA Change: R60C

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Meta Mutation Damage Score 0.1633 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for non functional alleles at this locus die prematurely. There is an increased tumor incidence and abnormalities in a variety of systems in mice as they become moribund. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,321,776 (GRCm39) P405S probably damaging Het
Adamts3 A G 5: 89,855,312 (GRCm39) probably benign Het
Angptl2 T C 2: 33,118,814 (GRCm39) V196A probably benign Het
Aoc1 A T 6: 48,882,778 (GRCm39) H240L probably damaging Het
Arsj A T 3: 126,158,624 (GRCm39) T68S probably benign Het
Atp8b3 T C 10: 80,362,014 (GRCm39) K708E probably benign Het
Bahd1 G A 2: 118,753,004 (GRCm39) R757H probably damaging Het
Ceacam5 T A 7: 17,448,901 (GRCm39) V89E probably benign Het
Cpt1b T C 15: 89,307,944 (GRCm39) E205G possibly damaging Het
Dhrs7c C T 11: 67,700,699 (GRCm39) T82I probably benign Het
Efs C T 14: 55,157,681 (GRCm39) R117Q probably damaging Het
Evl T C 12: 108,614,567 (GRCm39) probably benign Het
Fam89b A T 19: 5,781,761 (GRCm39) probably null Het
Fbxo16 T C 14: 65,531,233 (GRCm39) F46L probably damaging Het
Glp1r T A 17: 31,143,531 (GRCm39) L189H probably damaging Het
Gstp1 G A 19: 4,086,695 (GRCm39) T110I possibly damaging Het
Hbq1a T G 11: 32,250,715 (GRCm39) S133A probably benign Het
Hhipl1 A G 12: 108,277,948 (GRCm39) E92G probably damaging Het
Il18r1 C T 1: 40,526,249 (GRCm39) T265M probably damaging Het
Lpp T C 16: 24,708,636 (GRCm39) V447A probably benign Het
Mfsd13a C T 19: 46,360,431 (GRCm39) R328C probably damaging Het
Mmel1 C T 4: 154,969,955 (GRCm39) probably benign Het
Myo5c A G 9: 75,170,283 (GRCm39) E471G probably damaging Het
Obscn A G 11: 58,922,003 (GRCm39) L317P probably damaging Het
Or8b57 A T 9: 40,003,845 (GRCm39) M139K probably damaging Het
Psg18 A G 7: 18,083,096 (GRCm39) V232A possibly damaging Het
Ptprt T C 2: 161,769,449 (GRCm39) E472G probably damaging Het
Rap2a G T 14: 120,741,170 (GRCm39) A158S possibly damaging Het
Rbm15 A T 3: 107,237,993 (GRCm39) S802T probably benign Het
Sec14l5 A G 16: 4,996,463 (GRCm39) I470V possibly damaging Het
Serpinb1a T C 13: 33,026,842 (GRCm39) T367A possibly damaging Het
Sirpb1a A G 3: 15,491,447 (GRCm39) W7R probably damaging Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Taf5 A C 19: 47,064,272 (GRCm39) K405T probably damaging Het
Tbc1d19 T C 5: 54,005,548 (GRCm39) probably benign Het
Trim58 T C 11: 58,537,787 (GRCm39) probably benign Het
Tssk4 A G 14: 55,889,152 (GRCm39) N226S probably damaging Het
Uggt1 C A 1: 36,249,140 (GRCm39) E267* probably null Het
Zdhhc23 T A 16: 43,794,533 (GRCm39) probably benign Het
Zfp407 G A 18: 84,226,871 (GRCm39) A2246V probably damaging Het
Zfp872 C T 9: 22,111,750 (GRCm39) R410* probably null Het
Other mutations in Mcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mcm2 APN 6 88,870,383 (GRCm39) missense probably benign 0.04
IGL01082:Mcm2 APN 6 88,864,859 (GRCm39) missense probably benign 0.05
IGL01451:Mcm2 APN 6 88,868,948 (GRCm39) splice site probably benign
IGL01534:Mcm2 APN 6 88,864,700 (GRCm39) critical splice donor site probably null
IGL01670:Mcm2 APN 6 88,864,614 (GRCm39) unclassified probably benign
IGL01724:Mcm2 APN 6 88,863,044 (GRCm39) missense probably damaging 1.00
IGL01936:Mcm2 APN 6 88,868,708 (GRCm39) missense probably damaging 1.00
IGL02082:Mcm2 APN 6 88,865,218 (GRCm39) nonsense probably null
dander UTSW 6 88,864,786 (GRCm39) missense possibly damaging 0.53
spores UTSW 6 88,874,432 (GRCm39) missense probably benign
R0254:Mcm2 UTSW 6 88,860,998 (GRCm39) missense probably damaging 0.99
R1673:Mcm2 UTSW 6 88,869,060 (GRCm39) missense probably benign 0.12
R1740:Mcm2 UTSW 6 88,861,026 (GRCm39) missense probably damaging 1.00
R1761:Mcm2 UTSW 6 88,866,770 (GRCm39) missense possibly damaging 0.90
R1917:Mcm2 UTSW 6 88,868,785 (GRCm39) missense possibly damaging 0.88
R2250:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2307:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2308:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2309:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2379:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3431:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3878:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3911:Mcm2 UTSW 6 88,865,234 (GRCm39) missense probably damaging 0.98
R3934:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3936:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R4640:Mcm2 UTSW 6 88,864,786 (GRCm39) missense possibly damaging 0.53
R4749:Mcm2 UTSW 6 88,868,973 (GRCm39) missense possibly damaging 0.95
R5267:Mcm2 UTSW 6 88,874,432 (GRCm39) missense probably benign
R5701:Mcm2 UTSW 6 88,870,073 (GRCm39) missense probably damaging 1.00
R5872:Mcm2 UTSW 6 88,861,053 (GRCm39) missense probably benign 0.05
R6118:Mcm2 UTSW 6 88,864,818 (GRCm39) missense probably damaging 1.00
R6152:Mcm2 UTSW 6 88,866,891 (GRCm39) critical splice acceptor site probably benign
R6207:Mcm2 UTSW 6 88,862,844 (GRCm39) missense probably benign 0.00
R6550:Mcm2 UTSW 6 88,863,941 (GRCm39) critical splice donor site probably null
R7184:Mcm2 UTSW 6 88,868,776 (GRCm39) missense probably damaging 1.00
R7303:Mcm2 UTSW 6 88,864,928 (GRCm39) missense probably damaging 1.00
R8069:Mcm2 UTSW 6 88,869,039 (GRCm39) missense probably damaging 1.00
R8215:Mcm2 UTSW 6 88,874,293 (GRCm39) missense probably damaging 0.98
R9121:Mcm2 UTSW 6 88,861,019 (GRCm39) missense probably benign
R9745:Mcm2 UTSW 6 88,868,729 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTGAGTTCAGTGCGGCAC -3'
(R):5'- TTGCTACCCAAGACAGCAGC -3'

Sequencing Primer
(F):5'- GCCAGCAGGATACAGAAGCC -3'
(R):5'- CCAAGACAGCAGCGAGGAAG -3'
Posted On 2015-02-18