Incidental Mutation 'R3432:Psg18'
ID 266236
Institutional Source Beutler Lab
Gene Symbol Psg18
Ensembl Gene ENSMUSG00000003505
Gene Name pregnancy specific glycoprotein 18
Synonyms Cea-3, Cea3, mmCGM6
MMRRC Submission 040650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R3432 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 18345422-18355009 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18349171 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 232 (V232A)
Ref Sequence ENSEMBL: ENSMUSP00000096380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003597] [ENSMUST00000098783]
AlphaFold B2RSG7
Predicted Effect probably benign
Transcript: ENSMUST00000003597
AA Change: V353A

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000003597
Gene: ENSMUSG00000003505
AA Change: V353A

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 140 2.11e-2 SMART
IG 161 262 1.03e0 SMART
IG 281 380 2.15e-3 SMART
IGc2 398 462 1.58e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098783
AA Change: V232A

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096380
Gene: ENSMUSG00000003505
AA Change: V232A

DomainStartEndE-ValueType
IG 40 141 1.03e0 SMART
IG 160 259 2.15e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183222
Meta Mutation Damage Score 0.3551 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,394,039 P405S probably damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Arsj A T 3: 126,364,975 T68S probably benign Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Dhrs7c C T 11: 67,809,873 T82I probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fam89b A T 19: 5,731,733 probably null Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Gstp1 G A 19: 4,036,695 T110I possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Olfr983 A T 9: 40,092,549 M139K probably damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rbm15 A T 3: 107,330,677 S802T probably benign Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Serpinb1a T C 13: 32,842,859 T367A possibly damaging Het
Sirpb1a A G 3: 15,426,387 W7R probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Zfp872 C T 9: 22,200,454 R410* probably null Het
Other mutations in Psg18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Psg18 APN 7 18354816 start codon destroyed probably null 0.99
IGL01748:Psg18 APN 7 18353551 missense probably benign 0.05
IGL01767:Psg18 APN 7 18353397 missense possibly damaging 0.80
IGL02727:Psg18 APN 7 18345950 missense probably damaging 1.00
IGL02744:Psg18 APN 7 18349402 missense probably benign 0.38
G1Funyon:Psg18 UTSW 7 18353377 missense probably damaging 0.99
PIT4466001:Psg18 UTSW 7 18349316 missense probably benign 0.30
R0331:Psg18 UTSW 7 18353308 missense probably benign 0.03
R1077:Psg18 UTSW 7 18351075 missense possibly damaging 0.84
R1171:Psg18 UTSW 7 18346079 missense probably benign 0.10
R1173:Psg18 UTSW 7 18354817 start codon destroyed probably null 0.97
R1234:Psg18 UTSW 7 18349190 missense probably damaging 1.00
R1553:Psg18 UTSW 7 18353481 missense probably benign 0.19
R1632:Psg18 UTSW 7 18350899 missense probably benign 0.02
R2108:Psg18 UTSW 7 18350874 missense probably damaging 1.00
R2439:Psg18 UTSW 7 18346119 missense probably benign 0.24
R3032:Psg18 UTSW 7 18350979 missense probably benign 0.01
R3053:Psg18 UTSW 7 18349193 missense probably damaging 1.00
R3725:Psg18 UTSW 7 18354823 start gained probably benign
R4479:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4480:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4846:Psg18 UTSW 7 18350786 nonsense probably null
R4858:Psg18 UTSW 7 18353484 missense possibly damaging 0.49
R5010:Psg18 UTSW 7 18349354 missense probably damaging 1.00
R5225:Psg18 UTSW 7 18345949 missense probably damaging 1.00
R5450:Psg18 UTSW 7 18353425 missense probably benign 0.32
R5526:Psg18 UTSW 7 18349348 missense probably damaging 1.00
R5840:Psg18 UTSW 7 18346602 intron probably benign
R6409:Psg18 UTSW 7 18353521 missense probably benign
R7164:Psg18 UTSW 7 18350937 missense possibly damaging 0.89
R7276:Psg18 UTSW 7 18345984 missense probably damaging 0.99
R7768:Psg18 UTSW 7 18346028 missense probably damaging 1.00
R8301:Psg18 UTSW 7 18353377 missense probably damaging 0.99
R8700:Psg18 UTSW 7 18353625 missense probably damaging 1.00
R8982:Psg18 UTSW 7 18349375 missense probably benign 0.20
R9042:Psg18 UTSW 7 18349122 missense probably benign 0.44
R9054:Psg18 UTSW 7 18353525 missense possibly damaging 0.82
R9442:Psg18 UTSW 7 18349260 nonsense probably null
Z1176:Psg18 UTSW 7 18354787 missense probably benign 0.07
Z1177:Psg18 UTSW 7 18349115 missense probably benign 0.30
Z1177:Psg18 UTSW 7 18349198 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTGGTACAGCCCATGTGTGC -3'
(R):5'- CCATAATCTGCCAGAAGATGTGC -3'

Sequencing Primer
(F):5'- GTGCCCAAATACCAATGTGATG -3'
(R):5'- CCAGAAGATGTGCAAACCTTTTCCTG -3'
Posted On 2015-02-18