Incidental Mutation 'R3432:Olfr983'
ID266239
Institutional Source Beutler Lab
Gene Symbol Olfr983
Ensembl Gene ENSMUSG00000044205
Gene Nameolfactory receptor 983
SynonymsMOR162-1, GA_x6K02T2PVTD-33790948-33790013
MMRRC Submission 040650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3432 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location40086908-40093595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40092549 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 139 (M139K)
Ref Sequence ENSEMBL: ENSMUSP00000083206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050996] [ENSMUST00000213087] [ENSMUST00000213858] [ENSMUST00000214856] [ENSMUST00000217536]
Predicted Effect probably damaging
Transcript: ENSMUST00000050996
AA Change: M139K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083206
Gene: ENSMUSG00000044205
AA Change: M139K

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2e-48 PFAM
Pfam:7TM_GPCR_Srsx 39 307 3.1e-5 PFAM
Pfam:7tm_1 45 293 1.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213087
AA Change: M135K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000213858
Predicted Effect probably benign
Transcript: ENSMUST00000214856
Predicted Effect probably benign
Transcript: ENSMUST00000217536
Meta Mutation Damage Score 0.6905 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,394,039 P405S probably damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Arsj A T 3: 126,364,975 T68S probably benign Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Dhrs7c C T 11: 67,809,873 T82I probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fam89b A T 19: 5,731,733 probably null Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Gstp1 G A 19: 4,036,695 T110I possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Psg18 A G 7: 18,349,171 V232A possibly damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rbm15 A T 3: 107,330,677 S802T probably benign Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Serpinb1a T C 13: 32,842,859 T367A possibly damaging Het
Sirpb1a A G 3: 15,426,387 W7R probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Zfp872 C T 9: 22,200,454 R410* probably null Het
Other mutations in Olfr983
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Olfr983 APN 9 40092733 missense probably damaging 1.00
IGL01329:Olfr983 APN 9 40092028 missense possibly damaging 0.90
IGL01892:Olfr983 APN 9 40092818 missense probably damaging 1.00
IGL02712:Olfr983 APN 9 40092786 missense probably damaging 0.99
R0025:Olfr983 UTSW 9 40092253 missense probably damaging 1.00
R0066:Olfr983 UTSW 9 40092687 missense possibly damaging 0.74
R0136:Olfr983 UTSW 9 40092019 makesense probably null
R0715:Olfr983 UTSW 9 40092511 missense probably damaging 1.00
R2345:Olfr983 UTSW 9 40092553 missense probably benign 0.09
R5027:Olfr983 UTSW 9 40092394 missense probably damaging 1.00
R6874:Olfr983 UTSW 9 40092726 missense probably benign 0.22
R7818:Olfr983 UTSW 9 40092712 missense probably damaging 1.00
R7823:Olfr983 UTSW 9 40092348 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCAGAATGGATGCGGAG -3'
(R):5'- CCCAAAATGCTGGTGGGTTTTG -3'

Sequencing Primer
(F):5'- CCACCAGTTCATTGATGGAGG -3'
(R):5'- GTGAAGCAGAACATCATCTCTCATG -3'
Posted On2015-02-18