Mutagenetix > Incidental Mutation

Incidental Mutation 'R3432:Atp8b3'

266242

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

040650-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R3432 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80526180 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 708 (K708E)

Ref Sequence

ENSEMBL: ENSMUSP00000151571 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

probably benign
Transcript: ENSMUST00000020383
AA Change: K708E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: K708E

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220326
AA Change: K708E

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

Meta Mutation Damage Score

0.0986

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.7%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr3	G	A	1: 125,394,039	P405S	probably damaging	Het
Adamts3	A	G	5: 89,707,453		probably benign	Het
Angptl2	T	C	2: 33,228,802	V196A	probably benign	Het
Aoc1	A	T	6: 48,905,844	H240L	probably damaging	Het
Arsj	A	T	3: 126,364,975	T68S	probably benign	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Ceacam5	T	A	7: 17,714,976	V89E	probably benign	Het
Cpt1b	T	C	15: 89,423,741	E205G	possibly damaging	Het
Dhrs7c	C	T	11: 67,809,873	T82I	probably benign	Het
Efs	C	T	14: 54,920,224	R117Q	probably damaging	Het
Evl	T	C	12: 108,648,308		probably benign	Het
Fam89b	A	T	19: 5,731,733		probably null	Het
Fbxo16	T	C	14: 65,293,784	F46L	probably damaging	Het
Glp1r	T	A	17: 30,924,557	L189H	probably damaging	Het
Gstp1	G	A	19: 4,036,695	T110I	possibly damaging	Het
Hbq1a	T	G	11: 32,300,715	S133A	probably benign	Het
Hhipl1	A	G	12: 108,311,689	E92G	probably damaging	Het
Il18r1	C	T	1: 40,487,089	T265M	probably damaging	Het
Lpp	T	C	16: 24,889,886	V447A	probably benign	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Mfsd13a	C	T	19: 46,371,992	R328C	probably damaging	Het
Mmel1	C	T	4: 154,885,498		probably benign	Het
Myo5c	A	G	9: 75,263,001	E471G	probably damaging	Het
Obscn	A	G	11: 59,031,177	L317P	probably damaging	Het
Olfr983	A	T	9: 40,092,549	M139K	probably damaging	Het
Psg18	A	G	7: 18,349,171	V232A	possibly damaging	Het
Ptprt	T	C	2: 161,927,529	E472G	probably damaging	Het
Rap2a	G	T	14: 120,503,758	A158S	possibly damaging	Het
Rbm15	A	T	3: 107,330,677	S802T	probably benign	Het
Sec14l5	A	G	16: 5,178,599	I470V	possibly damaging	Het
Serpinb1a	T	C	13: 32,842,859	T367A	possibly damaging	Het
Sirpb1a	A	G	3: 15,426,387	W7R	probably damaging	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Taf5	A	C	19: 47,075,833	K405T	probably damaging	Het
Tbc1d19	T	C	5: 53,848,206		probably benign	Het
Trim58	T	C	11: 58,646,961		probably benign	Het
Tssk4	A	G	14: 55,651,695	N226S	probably damaging	Het
Uggt1	C	A	1: 36,210,059	E267*	probably null	Het
Zdhhc23	T	A	16: 43,974,170		probably benign	Het
Zfp407	G	A	18: 84,208,746	A2246V	probably damaging	Het
Zfp872	C	T	9: 22,200,454	R410*	probably null	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCCATTGATAACCAAGGCCATG -3'
(R):5'- TGGACCAATCACTACAGCCG -3'

Sequencing Primer
(F):5'- TGATAACCAAGGCCATGTTGTG -3'
(R):5'- TACAGCCGGCCAGGAGATG -3'

Posted On

2015-02-18