Incidental Mutation 'R3432:Serpinb1a'
ID266249
Institutional Source Beutler Lab
Gene Symbol Serpinb1a
Ensembl Gene ENSMUSG00000044734
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 1a
SynonymsMNEI, LEI, 1190005M04Rik, EIA, ovalbumin, M/NEI, ELANH2
MMRRC Submission 040650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R3432 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location32842092-32851185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32842859 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 367 (T367A)
Ref Sequence ENSEMBL: ENSMUSP00000075690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076352] [ENSMUST00000091668]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076352
AA Change: T367A

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075690
Gene: ENSMUSG00000044734
AA Change: T367A

DomainStartEndE-ValueType
SERPIN 13 379 1.19e-190 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091668
SMART Domains Protein: ENSMUSP00000089257
Gene: ENSMUSG00000044734

DomainStartEndE-ValueType
SERPIN 13 348 1.5e-151 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223016
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of proteinase inhibitors. Members of this family maintain homeostasis by neutralizing overexpressed proteinase activity through their function as suicide substrates. This protein inhibits the neutrophil-derived proteinases neutrophil elastase, cathepsin G, and proteinase-3 and thus protects tissues from damage at inflammatory sites. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mice fail to clear P. aeruginosa lung infection and show increased mortality associated with late-onset failed bacterial clearance, partly due to elevated neutrophil necrosis, release of neutrophil protease activity, higher cytokine production and proteolysis of surfactant protein-D. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,394,039 P405S probably damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Arsj A T 3: 126,364,975 T68S probably benign Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Dhrs7c C T 11: 67,809,873 T82I probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fam89b A T 19: 5,731,733 probably null Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Gstp1 G A 19: 4,036,695 T110I possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Olfr983 A T 9: 40,092,549 M139K probably damaging Het
Psg18 A G 7: 18,349,171 V232A possibly damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rbm15 A T 3: 107,330,677 S802T probably benign Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Sirpb1a A G 3: 15,426,387 W7R probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Zfp872 C T 9: 22,200,454 R410* probably null Het
Other mutations in Serpinb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Serpinb1a APN 13 32845415 missense probably benign 0.03
IGL02470:Serpinb1a APN 13 32850393 missense probably damaging 0.98
IGL03215:Serpinb1a APN 13 32850369 missense probably damaging 0.99
R0047:Serpinb1a UTSW 13 32850276 missense probably damaging 1.00
R0047:Serpinb1a UTSW 13 32850276 missense probably damaging 1.00
R0121:Serpinb1a UTSW 13 32848771 splice site probably benign
R0335:Serpinb1a UTSW 13 32848656 missense probably damaging 1.00
R0387:Serpinb1a UTSW 13 32848738 missense probably benign 0.03
R0751:Serpinb1a UTSW 13 32843216 missense probably benign
R1184:Serpinb1a UTSW 13 32843216 missense probably benign
R2096:Serpinb1a UTSW 13 32847454 missense probably damaging 1.00
R2165:Serpinb1a UTSW 13 32850414 splice site probably benign
R5247:Serpinb1a UTSW 13 32850406 start codon destroyed probably damaging 1.00
R5669:Serpinb1a UTSW 13 32845316 missense probably damaging 1.00
R6274:Serpinb1a UTSW 13 32842866 missense probably damaging 1.00
R7133:Serpinb1a UTSW 13 32850325 missense possibly damaging 0.69
R7358:Serpinb1a UTSW 13 32842998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCATGCCAAAAGTCATGG -3'
(R):5'- TCTCTGGCATGTCAGGATCCAG -3'

Sequencing Primer
(F):5'- CCATGCCAAAAGTCATGGATATAAAG -3'
(R):5'- GCATGTCAGGATCCAGAGATCTTTTC -3'
Posted On2015-02-18