Incidental Mutation 'R3432:Gstp1'
ID266261
Institutional Source Beutler Lab
Gene Symbol Gstp1
Ensembl Gene ENSMUSG00000060803
Gene Nameglutathione S-transferase, pi 1
SynonymsGstpiB, Gst p-1
MMRRC Submission 040650-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R3432 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4035407-4037921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4036695 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 110 (T110I)
Ref Sequence ENSEMBL: ENSMUSP00000129565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042700] [ENSMUST00000169613]
PDB Structure
GLUTATHIONE S-TRANSFERASE YFYF CYS 47-CARBOXYMETHYLATED CLASS PI, FREE ENZYME [X-RAY DIFFRACTION]
1.8 ANGSTROMS MOLECULAR STRUCTURE OF MOUSE LIVER CLASS PI GLUTATHIONE S-TRANSFERASE COMPLEXED WITH S-(P-NITROBENZYL)GLUTATHIONE AND OTHER INHIBITORS [X-RAY DIFFRACTION]
1.8 ANGSTROMS MOLECULAR STRUCTURE OF MOUSE LIVER CLASS PI GLUTATHIONE S-TRANSFERASE COMPLEXED WITH S-(P-NITROBENZYL)GLUTATHIONE AND OTHER INHIBITORS [X-RAY DIFFRACTION]
GLUTATHIONE S-TRANSFERASE YFYF, CLASS PI, COMPLEXED WITH GLUTATHIONE [X-RAY DIFFRACTION]
MODIFIED GLUTATHIONE S-TRANSFERASE (PI) COMPLEXED WITH S (P-NITROBENZYL)GLUTATHIONE [X-RAY DIFFRACTION]
MOLECULAR STRUCTURE AT 1.8 ANGSTROMS OF MOUSE LIVER CLASS PI GLUTATHIONE S-TRANSFERASE COMPLEXED WITH S-(P-NITROBENZYL)GLUTATHIONE AND OTHER INHIBITORS [X-RAY DIFFRACTION]
Mouse C14A Glutathione-S-Transferase Mutant in Complex with S-hexyl glutathione [X-RAY DIFFRACTION]
Mouse C14A Glutathione-S-Transferase Mutant in Complex with S-(p-nitrobenzyl) Glutathione [X-RAY DIFFRACTION]
Structure of Glutathione-S-Transferase C169A Mutant [X-RAY DIFFRACTION]
1.8 Angstroms molecular structure of mouse liver glutathione S-transferase mutant C47A complexed with S-(P-nitrobenzyl)glutathione [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000042700
SMART Domains Protein: ENSMUSP00000038931
Gene: ENSMUSG00000038155

DomainStartEndE-ValueType
Pfam:GST_N 2 75 4.2e-8 PFAM
Pfam:GST_C 97 188 1.4e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169613
AA Change: T110I

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129565
Gene: ENSMUSG00000060803
AA Change: T110I

DomainStartEndE-ValueType
Pfam:GST_N 4 75 2.3e-8 PFAM
Pfam:GST_C 97 188 1.5e-15 PFAM
Meta Mutation Damage Score 0.1614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Mutant mice with null mutations in both Gstp1 and Gstp2 exhibit an increased susceptibility to DMBA and TPA induced skin papillomas. Male mutant mice exhibit an increased body weight with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,394,039 P405S probably damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Arsj A T 3: 126,364,975 T68S probably benign Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Dhrs7c C T 11: 67,809,873 T82I probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fam89b A T 19: 5,731,733 probably null Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Olfr983 A T 9: 40,092,549 M139K probably damaging Het
Psg18 A G 7: 18,349,171 V232A possibly damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rbm15 A T 3: 107,330,677 S802T probably benign Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Serpinb1a T C 13: 32,842,859 T367A possibly damaging Het
Sirpb1a A G 3: 15,426,387 W7R probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Zfp872 C T 9: 22,200,454 R410* probably null Het
Other mutations in Gstp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1658:Gstp1 UTSW 19 4037375 missense probably damaging 0.99
R1848:Gstp1 UTSW 19 4036795 splice site probably benign
R6634:Gstp1 UTSW 19 4035510 missense probably benign 0.21
RF021:Gstp1 UTSW 19 4035507 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACCTCTCCTGAAGCTGTC -3'
(R):5'- TCTTGTTCAGGCTGCATCTG -3'

Sequencing Primer
(F):5'- TGAAGCTGTCTATTGGCCC -3'
(R):5'- TCATGAGCTCGGGTCTCACATG -3'
Posted On2015-02-18